Nerve Growth Factor neutralization promotes oligodendrogenesis by increasing miR-219a-5p levels
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA682600 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Alterations of the crosstalk between the nervous and immune systems may underlie the inflammatory and neurodegenerative changes characterizing Multiple Sclerosis (MS). Among the molecules that actively interconnect these two systems is the Nerve Growth Factor (NGF), involved in both regulating inflammation and in brain homeostasis. Additionally, NGF is known to modulate oligodendrogenesis and reduce myelination, further suggesting an involvement of NGF in MS ethiology. In this study, we find that NGF regulates oligodendrogenesis by modulating the levels of miR-219a-5p, a well-known positive regulator of oligodendrocyte (OL) differentiation. We utilized a transgenic NGF-deprivation mouse model, AD11, in which postnatal expression of an anti-NGF antibody leads to NGF neutralization and progressive neurodegeneration. Notably, we find that these mice also display increased myelination. A microRNA profiling of AD11 brain samples (hippocampus) by Agilent microarray analysis revealed that NGF deprivation leads to an increase of miR-219a-5p levels and a downregulation of its predicted targets, compared to AD11-VH control mice. The AD11-VH controls are transgenic mice where only the heavy chain of the transgenic antibody is expressed, while in AD11 mice express the whole functional antibody (heavy + light chain)
2021-02-15 | GSE162675 | GEO
Project description:In the brain, the neurotrophin Nerve growth factor (NGF) regulates not only neuronal survival and differentiation, but also glial and microglial functions and neuroinflammation. NGF is known to regulate oligodendrogenesis, reducing myelination in the central nervous system (CNS). In this study, we found that NGF controls oligodendrogenesis by modulating the levels of miR-219a-5p, a well-known positive regulator of oligodendrocyte differentiation. We exploited an NGF-deprivation mouse model, the AD11 mice, in which the postnatal expression of an anti-NGF antibody leads to NGF neutralization and progressive neurodegeneration. Notably, we found that these mice also display increased myelination. A microRNA profiling of AD11 brain samples and qRT-PCR analyses revealed that NGF deprivation leads to an increase of miR-219a-5p levels in hippocampus and cortex and a corresponding down-regulation of its predicted targets. Neurospheres isolated from the hippocampus of AD11 mice give rise to more oligodendrocytes and this process is dependent on miR-219a-5p, as shown by decoy-mediated inhibition of this microRNA. Moreover, treatment of AD11 neurospheres with NGF inhibits miR-219a-5p up-regulation and, consequently, oligodendrocyte differentiation, while anti-NGF treatment of wild type (WT) oligodendrocyte progenitors increases miR-219a-5p expression and the number of mature cells. Overall, this study indicates that NGF inhibits oligodendrogenesis and myelination by down-regulating miR-219a-5p levels, suggesting a novel molecular circuitry that can be exploited for the discovery of new effectors for remyelination in human demyelinating diseases, such as Multiple Sclerosis.
| S-EPMC7920049 | biostudies-literature
Project description:Epigenetic regulations, such as DNA methylation and microRNAs, play an important role in renal fibrosis. Here, we report the regulation of microRNA-219a-2 (mir-219a-2) by DNA methylation in fibrotic kidneys, unveiling the crosstalk between these epigenetic mechanisms. Through genome-wide DNA methylation analysis and pyro-sequencing, we detected the hypermethylation of mir-219a-2 in renal fibrosis induced by unilateral ureter obstruction (UUO) or renal ischemia/reperfusion, which was accompanied by a significant decrease in mir-219a-5p expression. Functionally, overexpression of mir-219a-2 enhanced fibronectin induction during hypoxia or TGF-b1 treatment of cultured renal cells. In mice, inhibition of mir-219a-5p suppressed fibronectin accumulation in UUO kidneys. ALDH1L2 was identified to be the direct target gene of mir-219a-5p in renal fibrosis. Mir-219a-5p suppressed ALDH1L2 expression in cultured renal cells, while inhibition of mir-219a-5p prevented the decrease of ALDH1L2 in UUO kidneys. Knockdown of ALDH1L2 enhanced PAI-1 induction during TGF-b1 treatment of renal cells, which was associated with fibronectin expression. In conclusion, the hypermethylation of mir-219a-2 in response to fibrotic stress attenuates mir-219a-5p expression and induces the up-regulation of its target gene ALDH1L2, which may reduce fibronectin deposition by suppressing PAI-1.
2023-11-01 | GSE236018 | GEO
Project description:Epigenetic regulations, such as DNA methylation and microRNAs, play an important role in renal fibrosis. Here, we report the regulation of microRNA-219a-2 (mir-219a-2) by DNA methylation in fibrotic kidneys, unveiling the crosstalk between these epigenetic mechanisms. Through genome-wide DNA methylation analysis and pyro-sequencing, we detected the hypermethylation of mir-219a-2 in renal fibrosis induced by unilateral ureter obstruction (UUO) or renal ischemia/reperfusion, which was accompanied by a significant decrease in mir-219a-5p expression. Functionally, overexpression of mir-219a-2 enhanced fibronectin induction during hypoxia or TGF-b1 treatment of cultured renal cells. In mice, inhibition of mir-219a-5p suppressed fibronectin accumulation in UUO kidneys. ALDH1L2 was identified to be the direct target gene of mir-219a-5p in renal fibrosis. Mir-219a-5p suppressed ALDH1L2 expression in cultured renal cells, while inhibition of mir-219a-5p prevented the decrease of ALDH1L2 in UUO kidneys. Knockdown of ALDH1L2 enhanced PAI-1 induction during TGF-b1 treatment of renal cells, which was associated with fibronectin expression. In conclusion, the hypermethylation of mir-219a-2 in response to fibrotic stress attenuates mir-219a-5p expression and induces the up-regulation of its target gene ALDH1L2, which may reduce fibronectin deposition by suppressing PAI-1.
2023-11-01 | GSE235842 | GEO
Project description:The goal of this study was to change the stoichiometry of Mir140-3p and Mir140-5p expression, thereby increasing the expression levels of Mir140-5p, and observe the biological effects on skeletal development. This was done by introducing two types of nucleotide changes into the seed regions of Mir140. The first was by changing the initial bases of Mir140-3p from 'TACCACAGGGTAGAACCACGGACAGGGTACTGGAGC' to 'CGCCACAGGGTAGAACCACGGACAGGGTACTGGAGC' lowering the expression levels of Mir140 3p and disrupting its function. The second change to alter Mir140 expression was by changing the Mir140-5p seed region from 'CAGTGGTTTTACCCTATGGAGG' to 'TAGTGGTTTTACCCTATGGAGG' increasing mi140-5p's ability to be bound by Argonaute.
2020-11-28 | GSE162266 | GEO
Project description:We investigated the effect of IL-13 neutralization on COVID-19 disease progression in mice.
2021-07-23 | GSE180557 | GEO
Project description:Purpose: To explore further into the mechanisms by which endothelial PD1 controls cerebrovascular development and oligodendrogenesis, we employed RNA-seq to examine genome-wide alterations in endothelial cells from P0 conditional PD1 knockout mice, comparing them with their wild-type littermates. Methods: mRNA was extracted from P0 isolated endothelial cells of Pd1fl/fl and Pd1cKO-Tie2 mice, and the quality and quantity were assessed using the Agilent 2100 Bioanalyzer. Subsequently, the mRNA was converted to cDNA and Libraries were prepared. RNA-sequencing was performed on the Illumina HiSeq 2500 platform at Annoroad Genomics. Results: Approximately one thousand transcripts showed differential expression between the Pd11fl/fl and Pd1cKO-Tie2 mice brain endothelial cell, with a fold change ≥2 and p value <0.05.Geneontology analysis of the downregulated genes were enriched in terms related to positive regulation of angiogenesis, positive regulation of vascular endothelial growth factor production and positive regulation of inflammatory response. Concomitantly, upregulated genes were enriched in terms related to endothelial cell migration, sequestering of BMP from receptor via BMP binding and regulation of establishment of blood-brain barrier. These results reflected endothelial PD1 plays vital roles in cortex development. Conclusions: Endothelial PD1 RNA-seq would provide a overall understanding how endothelium-derived PD1regulates vessel development and oligodendrogenesis during brain development
2024-05-13 | GSE267172 | GEO
Project description:Oncostatin M (OSM) is an IL-6 family cytokine that is necessary for neutrophil recruitment in pneumonia by inducing STAT3-dependent production of CXCL5. We used microarrays to identify additional pathways affected by OSM neutralization in the lungs during pneumonia.
2021-03-08 | GSE155283 | GEO
Project description:Neutralization of Oxidized Phospholipids Restrains Nonalcoholic Steatohepatitis
| PRJNA575823 | ENA