Ontology highlight
ABSTRACT:
PROVIDER: PRJNA810274 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR18136400_1.fastq.gz | Fastqsanger.gz | |||
| SRR18136400_2.fastq.gz | Fastqsanger.gz | |||
| SRR18136401_1.fastq.gz | Fastqsanger.gz | |||
| SRR18136401_2.fastq.gz | Fastqsanger.gz | |||
| SRR18136402_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 26 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Programmable nucleases and designer-recombinases are prominent genome editing tools that hold great potential for the treatment of human genetic disorders. However, both of these tools alone are not optimal for clinical applications. We present an approach that combines the ease of targeting of programmable nucleases with editing safety and accuracy of site-specific recombinases. We find that insertional fusions of zinc-finger DNA-binding domains (ZFDs) into the coding sequence of designer-recombinases generate conditional enzymes that are inactive, unless the ZFD binds its target site placed in the vicinity of the recombinase binding site. This induced-fit activity is transferable to a recombinase with relaxed specificity, representing the prototype of a new class of genome editing enzymes that opens exciting perspectives for flexible, seamless, and precise genome surgery.
2023-12-19 | GSE243676 | GEO
Project description:Zinc Finger Nucleases (ZFNs) facilitate precise editing of DNA enabling targeted genomic modifications in vivo. ZFNs have been employed to obtain genetically modified plants and animals, and cell-based therapies utilizing ZFNs are undergoing clinical trials. However, many ZFNs display dose-dependent toxicity presumably due to the generation of undesired double stranded breaks at off-target sites within the genome. To evaluate the parameters influencing the functional specificity of ZFNs, we compared the in vivo activity of ZFN variants targeting the zebrafish kdrl locus, which display both high on-target activity and dose-dependent toxicity. We evaluated their functional specificity by assessing lesion frequency at 141 potential off-target sites within the zebrafish genome using Illumina sequencing. Only a minority of these off-target sites displayed significant lesion frequency with kdrl ZFNs. Furthermore, we find that active off-target sites appear to be defined by the thermodynamics of zinc finger-DNA recognition. Surprisingly, we observed that the zinc finger protein specificity and the choice of the engineered dimerization domain of the FokI nuclease could independently influence the fidelity of these ZFNs. The results of this study have implications for the assessment of likely off-target sites within a genome and point to both ZFP-dependent and –independent mechanisms of potential improvement for engineering ZFNs with higher levels of precision. Examined lesions at 141 off-target sites for various treatments of ZFNs and compare to the untreated sample stage 1: raw read but missing quality values stage 2: fastq files available from SRA
2010-08-25 | E-GEOD-23762 | biostudies-arrayexpress
Project description:Transfer RNAs (tRNAs) are one of the most conserved components of protein synthesis machinery. An effective strategy for microbes to defend against viruses or competitors is to employ anticodon nucleases (ACNases) to deplete essential tRNAs and thereby shut off global protein synthesis, but this strategy has not been observed in multicellular eukaryotes. Here, we report that human SAMD9 is a virus-activatable ACNase that specifically depletes phenylalanine tRNA (tRNAPhe), causing codon-specific ribosomal pausing and inducing stress signaling. SAMD9 ACNase can be activated by poxvirus infection or by SAMD9 mutations associated with a spectrum of developmental or immunological disorders, implicating tRNAPhe deficiency as a major toxic effect in these human diseases and suggesting a new therapeutic strategy. The specificity of the ACNase, located to an N-terminal effector domain of SAMD9, is largely determined by a eukaryotic tRNAPhe specific 2’-O-methylation at the wobble position, making eukaryotic tRNAPhe a universal but specific target for SAMD9. The SAMD9 ACNase differs from the microbial ACNases in structure and substrate specificity, suggesting convergent evolution resulted in a universal immune defense strategy targeting tRNAs.
2023-06-07 | GSE230043 | GEO
Project description:RNA-guided nucleases (RGNs) based on CRISPR systems permit installing short and large edits within eukaryotic genomes. However, precise genome editing is often hindered due to nuclease off- target activities and the multiple-copy character of the vast majority of chromosomal sequences. Dual nicking RGNs and high-specificity RGNs both exhibit low off-target activities. Here, we report that high-specificity Cas9 nucleases are convertible into nicking Cas9D10A variants whose precision is superior to that of the commonly used Cas9D10A nickase. Dual nicking RGNs based on a selected group of these Cas9D10A variants can yield gene knockouts and gene knock-ins at frequencies similar to or higher than those achieved by their conventional counterparts. Moreover, high-specificity dual nicking RGNs are capable of distinguishing highly similar sequences by “tiptoeing” over pre-existing single base-pair polymorphisms. Finally, high-specificity RNA-guided nicking complexes generally preserve genomic integrity, as demonstrated by unbiased genome-wide high-throughput sequencing assays. Thus, in addition to substantially enlarging the Cas9 nickase toolkit, we demonstrate the feasibility in expanding the range and precision of genome editing procedures. The herein introduced tools and multi-tier high-specificity genome editing strategies might be particularly beneficial whenever predictability and/or safety of genetic manipulations are paramount.
2020-12-08 | GSE153471 | GEO
Project description:Because of their smallness, the recently developed CRISPR-Cas12f nucleases can be effectively packaged into adeno-associated viruses for gene therapy. However, a systematic evaluation of the editing outcomes of CRISPR-Cas12f is lacking. In this study, we apply a high-throughput sequencing method to comprehensively assess the editing efficiency, specificity, and safety of four Cas12f proteins in parallel with that of Cas9 and two Cas12a proteins at multiple genomic sites. Cas12f nucleases achieve robust cleavage at most of the tested sites and mainly produce deletional fragments. In contrast, Cas9 and Cas12a show relatively higher editing efficiency at the vast majority of the tested sites. However, the off-target hotspots identified in the Cas9- and Cas12a-edited cells are negligibly detected in the Cas12f-edited cells. Moreover, compared to Cas9 and Cas12a nucleases, Cas12f nucleases reduce the levels of chromosomal translocations, large deletions, and integrated vectors by 2- to 3-fold. Therefore, our findings confirm the editing capacity of Cas12f and reveal the ability of this nuclease family to preserve genome integrity during genome editing.
2022-09-12 | GSE213149 | GEO