Ontology highlight
ABSTRACT:
PROVIDER: PRJNA844334 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR19581441.fastq.gz | Fastqsanger.gz | |||
| SRR19581442.fastq.gz | Fastqsanger.gz | |||
| SRR19581443.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 3 of 3 |
Similar Datasets
Project description:The gut microbiome consists of trillions of bacteria, fungi, and viruses that inhabit the digestive tract. These communities are sensitive to disruption from environmental exposures ranging from diet changes to illness. Disruption of the community of lactic acid producing bacteria, Lactobaccillacea, has been well documented in mood disorders and stress exposure. In fact, oral supplement with many Lactobacillus species can ameliorate these effects, preventing depression- and anxiety-like behavior. Here, we utilize a gnotobiotic mouse colonized with the Altered Schaedler Flora to remove the two native species of Lactobaccillacea. Using this novel microbial community, we found that the Lactobacillus species themselves, and not the disrupted microbial communities are protective from environmental stressors. Further, we determine that Lactobaccillacea are maintaining homeostatic IFNγ levels which are mediating these behavioral and circuit level responses. By utilizing the Altered Schaedler Flora, we have gained new insight into how probiotics influence behavior and provide novel methods to study potential therapies to treat mood disorders.
2023-08-22 | GSE241110 | GEO
Project description:We used transcriptomics to investigate how Mucispirillum schaedleri ASF 457 interferes with the gene expression of Salmonella Typhimurium in the cecum of gnotobiotic mice
2018-11-09 | GSE122312 | GEO
Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
2026-01-28 | GSE291841 | GEO
Project description:Anaerobic bacteria in the oral cavity can cause respiratory infections. However, their precise mechanisms of action remain elusive. Unexpectedly, bacterial flora analysis using 16s rRNA revealed ‘hidden’ mixed infections of anaerobic bacteria and commensal oral Streptococcus species in community-acquired pneumonia. The purpose of this study is to elucidate the mechanisms by which Prevotella intermedia exacerbates oral streptococcal pneumonia.
2025-08-20 | GSE278151 | GEO
Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.
2024-08-22 | E-MTAB-14351 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO