Project description:The fermented and distilled Chinese alcoholic beverage strong flavor baijiu (SFB) gets its characteristic flavor during fermentation in cellars lined with pit mud. Microbes in the pit mud produce many key precursors of flavor esters. The over 20 year maturation time of natural pit mud have promoted attempts to produce artificial pit mud (APM) with shorter maturation time. However, knowledge on the molecular basis of APM microbial dynamics and associated functional variation during SFB brewing is limited, and the role of this variability in high quality SFB production remains poorly understood. We studied APM maturation in new cellars till the fourth brewing batch using 16S rRNA gene amplicon sequencing, real-time quantitative PCR and function prediction based on the sequencing results, and metaproteomics and metabolomics techniques. The results provide insight into global APM prokaryotic dynamics and their role in SFB production, which will be helpful for further optimization of APM culture technique and improvement of SFB quality.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.