Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
| 2255499 | ecrin-mdr-crc
Project description:High throughput sequencing of the 16S rRNA of the pre -pit fermentation grain samples
| PRJNA898131 | ENA
Project description:High throughput sequencing of the 16S rRNA of the pre -pit fermentation grain samples
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:In order to investigate the diurnal oscillations of ruminal bacteria, and their responses to the changes in different feeding patterns, we conducted an animal experiment by feeding the sheep ad libitum with a hay-based diet (50% of alfalfa hay and 46% of oats hay) and a grain-based diet (45% of corn meal and 11% of soybean meal) for 30 days, and ruminal fluid samples were collected at six different timepoints from T2 to T22 in one day, and the composition and diversity of the bacterial communities in rumen microbiomes of the sheep in the Grain-diet and Hay-diet groups at different timepoints were analyzed through 16S rRNA sequencing.