Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA amplicon sequencing

PROVIDER: PRJNA955162 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR24161400.fastq.gz	Fastqsanger.gz
	SRR24161401.fastq.gz	Fastqsanger.gz
	SRR24161402.fastq.gz	Fastqsanger.gz
	SRR24161403.fastq.gz	Fastqsanger.gz
	SRR24161404.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 24

Similar Datasets

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Bioaerosols in swine confinement buildings: A metaproteomic view

Project description:Swine confinement buildings (SCBs) represent workplaces with high biological air pollution. It is suspected that individual components of inhalable air are causatives of chronic respiratory disease that are regularly detected among workers. In order to understand the relationship between exposure and stress, the aim of this study was to develop a method to investigate the components of bioaerosols in more detail. For this purpose, bioaerosols from pig barns were collected on quartz filters from two exclusively housed pig types (porkers and gestating sows) and subsequently analyzed via a combinatorial approach of 16S rRNA amplicon sequencing and metaproteomics. The workflow helps to clarify diversity in bioaerosols from a taxonomic perspective, but also from a functional perspective.

2024-01-26 | PXD039685 | Pride

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

Changes of intestinal flora in patients with epithelial ovarian cancer treated with PARP inhibitor first-line maintenance therapy: a non-randomized, double-blind, observational cohort study

Project description:Interventions: Follow-up observation group:no;A drug maintenance treatment group:no;Two kinds of drugs maintenance treatment group:no Primary outcome(s): 16s rRNA sequencing results;Evaluation of therapeutic response in solid tumors Study Design: Cohort study

| 105717 | ecrin-mdr-crc

The effect of IV iron on the gut microbiome in patients with metastatic colorectal cancer

Project description:Primary outcome(s): Analysis of the diversity and composition of the gut microbiome by 16S rRNA sequencing Study Design: Observational Study Model : Others, Time Perspective : Prospective, Enrollment : 60, Biospecimen Retention : Collect & Archive- Sample with DNA, Biospecimen Description : Blood, Stool

| 26030 | ecrin-mdr-crc

LC-MS/MS of autotrophic culture KS, that performs nitrate reduction coupled to iron(II) oxidation (NDFO)

Project description:Nitrate-reducing iron(II)-oxidizing bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture KS. Raw sequencing data of 16S rRNA amplicon sequencing, shotgun metagenomics (short reads: Illumina; long reads: Oxford Nanopore Technologies), metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA682552. This dataset contains proteomics data for 2 conditions (heterotrophic and autotrophic growth conditions) in triplicates.

2021-05-17 | PXD023186 | Pride

Multiomic Approach to Analyze Infant Gut Microbiota: Experimental and Analytical Method Optimization

Project description:BACKGROUND: The human intestinal microbiome plays a central role in overall health status, especially in early life stages. 16S rRNA amplicon sequencing is used to profile its taxonomic composition; however, multiomic approaches have been proposed as the most accurate methods for study of the complexity of the gut microbiota. In this study, we propose an optimized method for bacterial diversity analysis that we validated and complemented with metabolomics by analyzing fecal samples.METHODS: Forty-eight different analytical combinations regarding (1) 16S rRNA variable region sequencing, (2) a feature selection approach, and (3) taxonomy assignment methods were tested. A total of 18 infant fecal samples grouped depending on the type of feeding were analyzed by the proposed 16S rRNA workflow and by metabolomic analysis.RESULTS: The results showed that the sole use of V4 region sequencing with ASV identification and VSEARCH for taxonomy assignment produced the most accurate results. The application of this workflow showed clear differences between fecal samples according to the type of feeding, which correlated with changes in the fecal metabolic profile.CONCLUSION: A multiomic approach using real fecal samples from 18 infants with different types of feeding demonstrated the effectiveness of the proposed 16S rRNA-amplicon sequencing workflow.

2021-08-18 | MTBLS2942 | MetaboLights

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data