Project description:We genearted a DNA aptamer against EPX via SELEX protocol using a random DNA library and developed an assay to monitor EPX in patients spitum samples After 15 rounds of selection, the aptamer sequences were obtained by high throughput sequencing
2022-09-25 | GSE213923 | GEO
Project description:Aptamer sequence library from SELEX
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
Project description:To systematically delineate the Protein–Protein Interaction (PPI) network between ASFV and host immune pathway proteins, and ASFV-ASFV PPI, we used the recombination-based library vs library high-throughput yeast two-hybrid (RLL-Y2H) screening system.
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
Project description:African swine fever virus (ASFV) is a highly infectious and lethal swine pathogen that causes severe socio-economic consequences in affected countries. Unfortunately, effective vaccine for combating ASF is unavailable so far, and the prevention and control strategies for ASFV are still very limited. Toosendanin (TSN), a triterpenoid saponin extracted from the medicinal herb Melia toosendan Sieb. Et Zucc, has been demonstrated to possess analgesic, anti-inflammatory, anti-botulism and anti-microbial activities, and was used clinically as an anthelmintic, while the antiviral effect of TSN on ASFV has not been reported. In this study, we revealed that TSN exhibited a potent inhibitory effect on ASFV GD955-38 strain in porcine alveolar macrophages (PAMs) (EC50=0.085 μM, SI = 365) in a dose-dependent manner. TSN showed robust antiviral activity in different doses of ASFV infection and reduced the transcription and translation levels of ASFV p30 protein, viral genomic DNA quantity as well as viral titer at 24 and 48 hours post-infection. In addition, TSN did not affect virion attachment and release but intervened in its internalization in PAMs. Further investigations disclosed that TSN played its antiviral role by upregulating the host IFN-stimulated gene (ISG) IRF1 rather than by directly inactivating the virus particles. Overall, our results suggest that TSN is an effective antiviral agent against ASFV replication in vitro and may have the potential for clinical use.
Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.
Project description:African swine fever virus (ASFV) produces a fatal acute hemorrhagic fever in domesticated pigs that potentially is a worldwide economic threat. Using an expressed sequence tag (EST) library-based antisense method of random gene inactivation and a phenotypic screen for limitation of ASFV replication in cultured human cells, we identified six host genes whose cellular functions are required by ASFV. These included three loci, BAT3 (HLA-B-associated transcript 3), C1qTNF (C1q and tumor necrosis factor-related protein 6), and TOM40 (translocase of outer mitochondrial membrane 40), for which antisense expression from a tetracycline-regulated promoter resulted in reversible inhibition of ASFV production by >99%. The effects of antisense transcription of the BAT3 EST and also of expression in the sense orientation of this EST, which encodes amino acid residues 450 to 518 of the mature BAT3 protein, were investigated more extensively. Sense expression of the BAT3 peptide, which appears to reversibly interfere with BAT3 function by a dominant negative mechanism, resulted in decreased synthesis of viral DNA and proteins early after ASFV infection, altered transcription of apoptosis-related genes as determined by cDNA microarray analysis, and increased cellular sensitivity to staurosporine-induced apoptosis. Antisense transcription of BAT3 reduced ASFV production without affecting abundance of the virus macromolecules we assayed. Our results, which demonstrate the utility of EST-based functional screens for the detection of host genes exploited by pathogenic viruses, reveal a novel collection of cellular genes previously not known to be required for ASFV infection.
Project description:SELEX has greatly advanced aptamer discovery; however, traditional workflows face considerable challenges in scaling due to the labor-intensive screening and validation processes. More critically, in conventional SELEX, sequencing abundance does not always correlate directly with binding properties due to amplification bias, matrix adsorption, and initial copy-number advantages. We establish an automated framework that converts enrichment readouts into affinity- and specificity-informed candidate prioritization. The framework integrates two key innovations: a distribution-reset secondary screening and a relative abundance ratio for candidate selection. Furthermore, the 96-target workflow generates a systematically organized sequence-target dataset that can be utilized as a valuable resource for analyzing SELEX mechanisms and facilitating AI-assisted ap-tamer discovery. Here, we release the sequencing data of the enriched libraries. Within each sequence-protein matrix, the dataset integrates raw read counts, relative abundance ratios, sequence ranks, and target identities into a unified format. This structure preserves both successful and unsuccessful screening results, which are crucial for com-prehending target screenability and distinguishing genuine target-specific enrichment from general back-ground retention.