Sort   by:  
 Page size 
GenomicsThree distinct patterns of histone H3Y41 phosphorylation mark active genes
The aim of the project was to identify the global distribution of H3Y41ph and correlate its presence with the transcription factor STAT5 and the active histone modification H3K4me3. This was done in human erythroid leukaemia cells (HEL). HEL cells were treated with DMSO or a JAK2 inhibitor (TG101209...
ORGANISM(S): Homo sapiens 
2013-04-15 | E-MTAB-1096 | biostudies-arrayexpress
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
UnknownSuicide rates amongst individuals from ethnic minority backgrounds: A systematic review and meta-analysis.
Not available
S-EPMC9065636 | biostudies-literature
TranscriptomicsRUNX1 reshapes the epigenetic landscape at the onset of hematopoiesis
Cell fate decisions during hematopoiesis are governed by lineage-specific transcription factors, such as RUNX1, SCL/TAL1, FLI1 and C/EBP family members. In order to gain insight about how these transcription factors regulate the activation of hematopoietic genes during embryonic development, we meas...
ORGANISM(S): Mus musculus 
2013-02-11 | E-GEOD-39662 | biostudies-arrayexpress
TranscriptomicsGene expression analysis of Cbp deficient LSK cells
The transcriptional coactivator Cbp is critical for hematopoietic stem cell (HSC) development. However, its role in adult HSC and the mechanistic detail of Cbp control of HSC function remains unknown. Using conditional deletion of Cbp in the adult HSC compartment, we demonstrate an altered balance b...
ORGANISM(S): Mus musculus 
2011-12-15 | E-GEOD-25268 | biostudies-arrayexpress
GenomicsGenome-wide analysis of the binding pattern of the transcriptional co-activator Cbp.
The transcriptional coactivator Cbp is critical for hematopoietic stem cell (HSC) development. However, its role in adult HSC and the mechanistic detail of Cbp control of HSC function remain unknown. Using conditional deletion of Cbp in the adult HSC compartment, we demonstrate an altered balance be...
ORGANISM(S): Mus musculus 
2011-12-15 | E-GEOD-25265 | biostudies-arrayexpress
GenomicsCytokine-mediated differentiation reflects genome-wide loss of a uSTAT transcriptional program
uSTAT transcriptional program HPC7 cells were fixed with either 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and specific antibodies were used to pull down the transcription factors of insterest after a pre-clearing step. Chromatin was washed, de...
ORGANISM(S): Mus musculus 
2016-01-05 | E-GEOD-70697 | biostudies-arrayexpress
GenomicsRUNX1 reshapes the epigenetic landscape at the onset of hematopoiesis
Cell fate decisions during hematopoiesis are governed by lineage-specific transcription factors, such as RUNX1, SCL/TAL1, FLI1 and C/EBP family members. In order to gain insight about how these transcription factors regulate the activation of hematopoietic genes during embryonic development, we meas...
ORGANISM(S): Mus musculus 
2012-10-18 | E-GEOD-40235 | biostudies-arrayexpress
GenomicsGenome-wide analysis of GATA1, GATA2, RUNX1, FLI1 and SCL binding in primary human megakaryocytes
We have mapped the binding sites for the five key regulators GATA1, GATA2, RUNX1, FLI1 and TAL1/SCL in primary human megakaryocytes. Statistical analysis identified subsets of enriched as well as depleted combinatorial binding patterns. In particular simultaneous binding by all 5 factors was highly ...
ORGANISM(S): Homo sapiens 
2011-06-01 | E-GEOD-24674 | biostudies-arrayexpress
TranscriptomicsGene expression profiling of Human Umbilical Vein Endothelial Cells (HUVEC) after treatment with Erg or control antisense (GeneBloc)
The endothelial transcription factor Erg (Ets Related Gene) plays an important role in homeostasis and angiogenesis by regulating many endothelial functions including survival and junction stability. Here we show that Erg regulates endothelial cell migration. Transcriptome profiling of Erg-deficient...
ORGANISM(S): Homo sapiens 
2012-02-27 | E-GEOD-32984 | biostudies-arrayexpress
Sort   by:  
 Page size