Sort   by:  
 Page size 
MetabolomicsPu-erh tea and theabrownin ameliorate metabolic syndrome in mice via potential microbiota-gut-liver-brain interactions
Metabolic syndrome (MS) is a common metabolic disorder characterized by obesity, insulin resistance, cardiovascular disease and gut microbiota dysbiosis. Pu-erh tea and its ingredient theabrownin have known functions on the reduction of body weight gain and fat accumulation. However, few studies sys...
2024-09-25 | MTBLS2594 | MetaboLights
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
MetabolomicsTheabrownin from Pu-erh tea attenuates hypercholesterolemia via modulation of gut microbiota and bile acid metabolism
Pu-erh tea displays cholesterol-lowering properties, but the underlying mechanism has not been elucidated. Theabrownin is one of the most active and abundant pigments in Pu-erh tea. Here, we show that theabrownin alters the gut microbiota in mice and humans, predominantly suppressing microbes associ...
2021-11-18 | MTBLS1259 | MetaboLights
ProteomicsAnalysis of muscular proteomics of deep pressure ulcers reveals JAK2 influence on muscle autophagy and apoptosis
Pressure ulcers (PU) is a complex and serious clinical problem. Deep tissue injury is either the outcome or the trigger of deep PU. However, the cellular and molecular mechanisms that contribute to the pathogenesis of deep PU remain unclear. In this study, the degeneration characteristics, increased...
ORGANISM(S): Homo sapiens (Human) 
2019-11-12 | PXD009512 | Pride
Proteomics Ischemia/reperfusion injury Deep pressure ulcers Jak2 Autophagy & apoptosis 
UnknownCorrelation analysis between filamentous fungi and chemical compositions in a pu-erh type tea after a long-term storage.
Not available
S-EPMC7215201 | biostudies-literature
ProteomicsGene regulatory networks of kiwifruit response to Pseudomonas syringae pv. actinidiae
To study the responses of kiwifruit to Pseudomonas syringae pv. actinidiae, one-year-old potted seeding A. c. var. deliciosa cultivar ‘Jinkui’ and the pandemic Pseudomonas syringae pv. actinidiae bacterial strain JF8 (CCTCC AB2018305) were used for this study. This bacterial strain was originally is...
ORGANISM(S): Actinidia chinensis var. chinensis 
2021-11-10 | PXD014787 | Pride
Transcriptome Resistance Kiwifruit bacterial canker Proteome Kiwifruit 
UnknownPolyphenol- and Caffeine-Rich Postfermented Pu-erh Tea Improves Diet-Induced Metabolic Syndrome by Remodeling Intestinal Homeostasis in Mice.
Not available
S-EPMC5736808 | biostudies-literature
UnknownPU.1-CD23 signaling mediates pulmonary innate immunity against Aspergillus fumigatus infection by driving inflammatory response.
Not available
S-EPMC9844028 | biostudies-literature
UnknownPharmacokinetics, Tissue Distribution and Excretion of a Novel Diuretic (PU-48) in Rats.
Not available
S-EPMC6160999 | biostudies-literature
UnknownEffects of Geographical Origin and Tree Age on the Stable Isotopes and Multi-Elements of Pu-erh Tea.
Not available
S-EPMC10855849 | biostudies-literature
Sort   by:  
 Page size