Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

158 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

ABSTRACT: Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.

ORGANISM(S): Homo sapiens

SUBMITTER: Esther Baena

PROVIDER: E-GEOD-39357 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Distinct transcriptional programs controlled by ERG and ETV1 in prostate cells

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-03-01 | E-GEOD-39388 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq. To determine ETV1 and H3K4me1 localization, logarithmically growing cells

2013-06-13 | E-GEOD-47120 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Identification of target genes of Cud-type transcription factor, spaA, in a Dictyostelid social amoebae by ChIP-seq

Project description:spaA is a Cud-type transcription factor that is essential for spore cell differentiation of Dictyostelium discoideum, a social amoeba. ChIP-seq was performed to identify spaA target genes.

2018-05-31 | E-MTAB-6000 | biostudies-arrayexpress

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy.

2013-03-01 | GSE39357 | GEO

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

2013-03-01 | GSE39353 | GEO

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell. RWPE-1 stable cell clones overexpressing ERG and ETV1 were grown under normal conditions. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39353 | biostudies-arrayexpress

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions.

2013-03-01 | GSE39354 | GEO

seq-UP07329_H4K16ac:DAM1687546_N2_Eemb

Project description:This submission comes from a modENCODE project of Jason Lieb. For full list of modENCODE projects, see http://www.genome.gov/26524648 Project Goal: The focus of our analysis will be elements that specify nucleosome positioning and occupancy, control domains of gene expression, induce repression of the X chromosome, guide mitotic segregation and genome duplication, govern homolog pairing and recombination during meiosis, and organize chromosome positioning within the nucleus. Our 126 strategically selected targets include RNA polymerase II isoforms, dosage-compensation proteins, centromere components, homolog-pairing facilitators, recombination markers, and nuclear-envelope constituents. We will integrate information generated with existing knowledge on the biology of the targets and perform ChIP-seq analysis on mutant and RNAi extracts lacking selected target proteins.For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf EXPERIMENT TYPE: CHIP-seq. BIOLOGICAL SOURCE: Strain: N2; Developmental Stage: Early Embryo; Genotype: wild type; Sex: Hermaphrodite; EXPERIMENTAL FACTORS: Developmental Stage Early Embryo; temp (temperature) 20 degree celsius; Strain N2; Antibody MP07-329-H4K16ac (target is h4K16ac)

2014-04-10 | E-GEOD-56661 | biostudies-arrayexpress

Genome wide screen reveals WNT11, a noncanonical WNT gene, as a target of ETS transcription factor ERG

Project description:ERG is a transcription factor that is involved in leukomogenesis and its mRNA overexpression has been associated with poor prognosis in a subset of patients with T-cell acute lymphoblastic leukemia (T-ALL) and acute myeloid leukemia (AML). Herein, a genome-wide screen of ERG target genes was conducted by chromatin immunoprecipitation-on-chip (ChIP-chip) in Jurkat cells. 342 significant annotated regions were derived from ChIP-chip experiments. Seventeen candidate promoter regions resulted in at least two-fold enrichment by quantitative PCR. Notably, ERG potential targets included WNT signaling genes: WNT2, WNT9A, WNT11, CCND1, and FZD7. Functionally, expression of WNT11 was downregulated with siRNA ERG knockdown and substantially upregulated in a tet-on ERG-inducible assay in K562 cells. To investigate a role for ERG in WNT signaling, a WNT agonist was used to inhibit glycogen synthase kinase (GSK-3). This treatment resulted in an ERG-dependent proliferative growth advantage in the tet-on ERG-inducible system. Lastly, chromatin immunoprecipitation assays of primary leukemia blasts confirmed WNT11 promoter enrichment dependent on ERG mRNA expression. In conclusion, ERG transcriptional networks in leukemia are revealed. Specifically, WNT11 emerged as a target of ERG. We propose that overexpression of ERG in acute leukemia may lead to a proliferative advantage upon activation of WNT signals. ChIP-chip with ERG antibody C20 and combined C17/20 and nonspecificic IgG in Jurkat

2010-12-10 | E-GEOD-21495 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data