Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

94 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

ABSTRACT: Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell. RWPE-1 stable cell clones overexpressing ERG and ETV1 were grown under normal conditions. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

ORGANISM(S): Homo sapiens

SUBMITTER: Esther Baena

PROVIDER: E-GEOD-39353 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell.

2013-03-01 | GSE39353 | GEO

Profiling of RWPE cells stably over-expressing ETV1

2007-08-07 | GSE7701 | GEO

Profiling of RWPE cells stably over-expressing ETV1

Project description:RWPE benign prostatic epithelial cells were infected with a lentivirus expressing ETV1 or GUS (control), and stable clones were isolated by puromycin selection. ETV1 over-expression, recapitulating ETS gene rearrangements observed in vivo, confers invasiveness in the benign prostate cell line RWPE. Keywords: genetic modification Four hybridizations in total were performed using RWPE cells stably expressing ETV1 or GUS (control) on Agilent Whole Human Genome Oligonucleotide Microarrays. RWPE-ETV1 (Cy5) / RWPE-GUS (Cy3) and a dye flip were performed in duplicate

2010-05-27 | E-GEOD-7701 | biostudies-arrayexpress

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39354 | biostudies-arrayexpress

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

2013-03-01 | GSE39354 | GEO

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy.

2013-03-01 | GSE39357 | GEO

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression. Primary prostate cells were isolated and luminal prostate cells were FACS-sorted by CD49F+ Sca1- from the lineage (CD31, CD45, Ter119) negative fraction. Total RNA was extracted from three biological replicates, and amplified using NuGEN V2cDNA amplification kit. This was used to hybridize to Affymetrix expression arrays using the Mouse Genome 430 2.0 platform.

2013-03-01 | E-GEOD-39355 | biostudies-arrayexpress

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

2013-03-01 | E-GEOD-39357 | biostudies-arrayexpress

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

2013-03-01 | GSE39355 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

2013-05-10 | GSE46329 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data