Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

14 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

ABSTRACT: Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

ORGANISM(S): Homo sapiens

SUBMITTER: Esther Baena

PROVIDER: E-GEOD-39354 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions.

2013-03-01 | GSE39354 | GEO

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell. RWPE-1 stable cell clones overexpressing ERG and ETV1 were grown under normal conditions. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39353 | biostudies-arrayexpress

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

2013-03-01 | GSE39353 | GEO

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.

2013-03-01 | E-GEOD-39357 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.

2013-06-13 | GSE47120 | GEO

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression. Primary prostate cells were isolated and luminal prostate cells were FACS-sorted by CD49F+ Sca1- from the lineage (CD31, CD45, Ter119) negative fraction. Total RNA was extracted from three biological replicates, and amplified using NuGEN V2cDNA amplification kit. This was used to hybridize to Affymetrix expression arrays using the Mouse Genome 430 2.0 platform.

2013-03-01 | E-GEOD-39355 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

2013-06-13 | E-GEOD-47120 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | GSE46329 | GEO

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

2013-03-01 | GSE39357 | GEO