Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

18 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling by array of Antarctic krill across the moult cycle relative to an early intermoult stage

ABSTRACT: To generate differential gene expression profiles across the moult cycle of Antarctic krill, relative to an early intermoult stage.

ORGANISM(S): Euphausia superba

SUBMITTER: Paul Seear

PROVIDER: E-MEXP-2605 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Seasonal and spatial influences on gene expression in Antarctic krill.

Project description:Effect of season and winter lattitude on gene expression in Antarctic krill.

2012-11-01 | E-MEXP-3453 | biostudies-arrayexpress

Transcription profiling of human hepatic and pancreatic stellate cells obtained from tissues of chronic inflammation, and primary or metastatic cancers

Project description:Differences in the expression profile of hepatic and pancreatic stellate cells are investigated. Aim is to identify organ and disease specific transcriptome signatures of stellate cells, comparing hepatic and pancreatic stellate cells obtained from tissues of chronic inflammation, and primary or metastatic cancers of the pancreas. Tissues of chronic pancreatitis (n=6), pancreatic ductal adenocarcinoma (n=5), liver cirrhosis (n=5) and liver metastasis of pancreatic ductal adenocarcinoma (n=6) were collected and stellate cells were isolated by the outgrowth method. Using cDNA microarrays, differentially expressed genes are identified.

2010-01-15 | E-TABM-625 | biostudies-arrayexpress

siRNAi profiling of mouse thymus treated with GIM anti-AIRE

Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).

2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress

Transcription profiling of 13.5dpc embryonic gonad/mesonephros from male Mrotm1H/Mrotm1H mice vs male wild type littermates

Project description:Direct comparison of gene expression in 13.5dpc embryonic gonad/mesonephros between male Mrotm1H/Mrotm1H mice and male wild-type littermates. Two independent pools of 10 gonads (5 mice) were compared on 4 microarrays (two colourswaps).

2007-01-09 | E-MEXP-527 | biostudies-arrayexpress

Transcription profiling of chicken lung to investigate responses to avian influenza virus

Project description:Transcription profiling of chicken lung to investigate responses to avian influenza virus

2009-07-31 | E-TABM-636 | biostudies-arrayexpress

Transcription profiling of chicken trachea to investigate responses to avian influenza virus

Project description:Transcription profiling of chicken trachea to investigate responses to avian influenza virus

2009-07-31 | E-TABM-637 | biostudies-arrayexpress

Transcription profiling by array of human olfactory ecto-mesenchymal stem cells in familial dysautonomia

Project description:Exploration of transcriptome expression in 5 control and 4 familial dysautonomia (FD) human olfactory ecto-mesenchymal stem cells (hOE-MSCs) at very early (P1 and P2) and later (P5 and P9) cell passages.

2011-01-01 | E-MTAB-281 | biostudies-arrayexpress

Transcription profiling of human embryonic kidney cell line HEK293T to investigate the effects of overexpression of FoxO4 or mutated FoxO4 in presence or absence of p300

Project description:Effects of overexpression of FoxO4 or mutated FoxO4 in presence or absence of p300 overexpression

2009-07-30 | E-MTAB-4 | biostudies-arrayexpress

Transcription profiling of the Arctic springtail Megaphorura arctica after cold or salt dehydration to study insect cyroprotective dehydration

Project description:The 13,824 cDNA microarray was constructed by printing 6912 PCR-amplified cDNA clones in duplicate. These were derived from a previous EST study (Clark et al, 2007) and comprised 3840 clones from the Library D2 (fully dehydrated animals, cooled to -14°C) and 3072 clones from the Library D1 (dehydrated animals cooled to -2°C). The Stratagene SpotReport Alien Array Validation System (Stratagene, La Jolla, CA, USA) was included on the microarray. Construction and hybridization of the arrays were performed as described in Purac et al (2008) with the exception of the amino-modified primers used for the initial cDNA amplification for array printing, which in this study were: (pAL32FOR: TTCTCGGGAAGCGCG and M13 forward: GTAAAACGACGGCCAG). Hybridizations were performed using control animals in combination with the groups listed below. Six groups of animals were used for the hybridizations. Treatments were as follows: C = control = live animals from +5°C M2 = cold dehydrated animals, cooled to -2°C at a rate of 2°C/week M7 = cold dehydrated animals, cooled to -7°C at a rate of 2°C/week H18 = animals taken from -7°C, and left to recover for 18 hours at 4°C with moisture. Salt 0.9 = animals slowly dehydrated over a saturated solution of sodium nitrate (which gives a constant humidity of 98% RH) to produce animals with a similar water content as the M2 animals Salt 0.2 = as for Salt 0.9, but the animals were dehydrated to a similar water content to the M7 animals. 6 biological replicates were performed for each condition, as well as some dye swaps.

2009-07-21 | E-MEXP-2105 | biostudies-arrayexpress

Transcription profiling of Laternula elliptica under heat stress

Project description:Microarray analysis of gene expression in the Antarctic clam Laternula elliptica after exposure to elevated temperatures

2010-08-03 | E-MEXP-2336 | biostudies-arrayexpress