RNA-seq of matched breast cancer and brain metastasis cell lines
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina NovaSeq 6000
ORGANISM(S): Homo sapiens
SUBMITTER: Patrick Nylund
PROVIDER: E-MTAB-15278 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The Alternative Lengthening of Telomeres (ALT) facilitates telomere lengthening by a DNA strand invasion and copying mechanism. The nuclear receptor NR2F2 can bind to (TCAGGG)n variant repeats within telomeres and it has been proposed that this facilitates telomere interactions in ALT+ cells. However, the role NR2F2 in regulation the gene expression in ALT+ cell lines is unclear. Here, using Next Generation Sequencing (NGS), we characterised the changes in expression profile of three ALT+ cell lines (W-V, WI38VA13/2RA, U2OS) upon transient siRNA mediated downregulation of NR2F2 compared to cells treated with a control siRNA . Among 86 ALT-associated genes, only MND1 showed consistent down-regulation across the three NR2F2-depleted ALT+ cell lines. Altogether our data indicate that NR2F2 it does not play a direct role in the ALT mechanism.
2020-12-15 | E-MTAB-9599 | biostudies-arrayexpress
Project description:These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. In order to be able to perform experiments using this pool, it was necessary to perform long-read sequencing of the plasmid pool to relate the barcodes in the 3' ends of the reporter to their gene structure. Therefore, we performed long-read sequencing of the plasmid pool (both the original pool used for transfection and the ePB plasmid used for PiggyBac integration). Furthermore, to determine the splicing patterns of the reporter genes, we transfected the plasmid pool into HeLa cells for 16 hours, then performed targeted long-read sequencing of the reporter plasmids via RT-PCR. Note: the Nanopore adapter ligation strategy means that reads can come in either orientation. To determine the gene architectures and barcodes, we used fuzzy string matching. First we matched to various fixed sequences throughout the reporter transcripts to determine the orientation of the read and that the read spanned the full length of the transcript. Then we used the same string matching strategy to detect the presence of the different intronic or exonic sequences - the gene architecture. Then we extracted the associated unique plasmid barcode associated with that gene architecture. Example reporter sequences can be found here: https://benchling.com/faraway/f_/kXCfddtQ-public-reporter-plasmid-maps/ or alternatively, in Supplemental Table 2 of the bioRxiv submission here: https://www.biorxiv.org/content/10.1101/2023.08.21.554177v1.supplementary-material
2025-07-29 | E-MTAB-13330 | biostudies-arrayexpress
Project description:These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. The reporter pool was expressed either via plasmid transfection or from a dox-incudible promoter. Cells were then fractionated to obtain nuclear and cytoplasmic RNA, and the barcode sequences were amplified to determine the abundance of each different reporter transcript in each fraction. Experiments were performed in triplicate and the nuclear and cytoplasmic fractions for all replicates were multiplexed into one file, which is provided here. Different expression times were sampled to determine how nuclear/cytoplasmic localisation changed in response to changes in PPIG-LCD protein accumulation. In one instance, the effect of the CLK inhibitor CLK-IN-T3 was tested. Multiple experimental conditions are provided: Experiment 1: transfection for 16 hours. Experiment 2: transfection for either 8 or 24 hours. Experiment 3: dox-induction for either 4, 8, or 12 hours. Note: expression kinetics are faster with dox induction than transfection. Experiment 4: dox-induction for 6 hours, either with 1 uM CLK-IN-T3 treatment, or with equivalent volume DMSO. Treatment began 2 hours before dox-induction. Each correct read in each sample should contain the following sequences in the following order: UMIs (N) and experimental barcodes (B): NNNNNBBBBNNNNN A fixed sequence: GGCCTGCGGATCC A unique plasmid barcode, which identifies the reporter transcript: NNNNNNNNNNNNNNNNNNNN A fixed sequence: GTTGTCGATCGAGACGTAAT Illumina adapter sequences. The experimental barcode arrangement for each sample is provided as a supplement to this accession.
2025-07-29 | E-MTAB-13329 | biostudies-arrayexpress
Project description:Gene expression analysis was performed on tumor-derived RNA from human PDAC xenograft to study the metabolic differences in the different PDAC subtypes
2021-12-31 | E-MTAB-10784 | biostudies-arrayexpress
Project description:Arginine-rich mixed charge domains (R-MCDs) contribute to and alter the properties of nuclear speckles. We are interested in how this affects the retention of poly-adenylated mRNAs in the nucleus. This experiment tests how the expression of the R-MCD of PPIG influences the nuclear-cytoplasmic distribution of mRNAs over time. Specifically, a HeLa cell line in which PPIG expression is driven by a doxycycline-inducible promoter was used, and doxycycline was added for 0, 4, 8 or 12 hours. This time course was performed in triplicates. Nuclear and cytoplasmic fractions were collected from the cells and RNA was extracted. 3' end sequencing libraries were produced by fragmenting the RNA and introducing Illumina adapters via a oligo-dT-primed reverse transcription and template switching oligo approach. The data indicate that mRNAs containing long, multivalent GA-rich regions in their coding sequences are more retained in the nucleus over time following expression of the R-MCD. The files provided in this accession have not been trimmed to remove adapters, 3' poly-A sequences, UMIs or G-stretches from TSOs. The data was analysed using nf-core/rna-seq using the following command: nextflow run nf-core/rnaseq \\ --input samplesheet.csv \\ --fasta '/camp/lab/ulej/home/users/farawar/genomes/hs/fasta/GRCh38.primary_assembly.genome.fa' \\ --gtf '/camp/lab/ulej/home/users/farawar/genomes/hs/annotation/gencode.v29.annotation.gtf' \\ --salmon_index '/camp/lab/ulej/home/users/farawar/genomes/hs/salmon_index/salmon_index' \\ --gencode \\ --pseudo_aligner salmon \\ --with_umi \\ --umitools_bc_pattern NNNNN \\ --clip_r1 5 \\ -resume \\ -profile crick \\ --outdir nf-core-results \\ -c extraconfig.config With the extra config file containing: withName: '.*:QUANTIFY_STAR_SALMON:SALMON_QUANT' { ext.args = '--noLengthCorrection' } Therefore removing the first 5 nucleotides as UMI sequences and the following 5 nucleotides as they contain G-stretches from the template-switching oligo.
2025-07-29 | E-MTAB-13304 | biostudies-arrayexpress
Project description:CLK kinases phosphorylate the SR domains of SR proteins. The phosphorylation state controls the localisation of SR proteins, with hypo-phosphorylated SR proteins being more enriched in nuclear speckles. We identified a set of mRNAs that are bound by SR proteins in the nucleus, and we wondered whether the activity of CLK kinases would alter the nuclear export of those mRNAs. We therefore treated HeLa cells with the CLK inhibitor CLK-IN-T3 or with DMSO for 8 hours and then collected nuclear and cytoplasmic fractions. We sequenced the 3' ends of poly-adenylated mRNAs in these fractions. The samples in this accession have been trimmed to remove Illumina adapters, 3' poly-A stretches, 5' G stretches from the TSO oligo and the UMIs have been moved to the header. The data was then processed using the following nf-core/rnaseq call: nextflow run nf-core/rnaseq \\ --input 'samplesheet.csv' \\ --fasta '/camp/lab/ulej/home/users/farawar/genomes/hs/fasta/GRCh38.primary_assembly.genome.fa' \\ --gtf '/camp/lab/ulej/home/users/farawar/genomes/hs/annotation/gencode.v29.annotation.gtf' \\ --salmon_index '/camp/lab/ulej/home/users/farawar/genomes/hs/salmon_index/salmon_index' \\ --gencode \\ --pseudo_aligner salmon \\ -resume \\ -profile crick \\ --outdir nf-core \\ -c extraconfig.config With the extra config file containing the following: withName: '.*:QUANTIFY_STAR_SALMON:SALMON_QUANT' { ext.args = '--noLengthCorrection' }
2025-07-29 | E-MTAB-13328 | biostudies-arrayexpress
Project description:P300/CBP and BET inhibition have synergistic effects in NMC. To explore the molecular mechanisms of this synergistic effect, transcriptomic profiling was performed in HCC2429 cells incubated with 250 nM A-485 and 50 nM JQ1 alone or combined.
2020-04-07 | E-MTAB-8955 | biostudies-arrayexpress
Project description:Identification of OVOL2-related transcriptional program in anaplastic thyroid carcinoma-derived cell line, 8505c. Doxycycline-inducible system was obtained by infecting 8505c cells with lentiviral vector containing OVOL2 coding sequence fused with HA tag. Control cells were infected with empty vector (EV). Cells were collected 24 hours upon doxycycline treatment.
2023-10-05 | E-MTAB-11055 | biostudies-arrayexpress
Project description:The goal of this experiment was to get deep into TRIM28 biological function in malignant pleural mesothelioma. To this end MSTO-211H cell line was infected by two different sgRNAs targeting TRIM28 and a non-targeting sgRNA as control. Two independent experiments were performed.RNA was collected 7 days after infection and changes in gene expression were analyzed by mRNA-seq.
2023-09-16 | E-MTAB-10942 | biostudies-arrayexpress
Project description:The aim of this experiment was to identify the RUNX2-dependent transcriptional program in thyroid cancer. To this end TPC1 cell line was infected with dCas9-KRAB and sgRNA targeting RUNX2 distal promoter or a non-targeting sgRNA as control. RNA was collected 10 days after infection and changes in gene expression were evaluated by mRNA-seq. Three replicates were analyzed.
2023-10-20 | E-MTAB-11049 | biostudies-arrayexpress