Project description:We report that Zinc Replenishment Reverses Overexpression of the Proinflammatory Mediator S100A8 and Esophageal Preneoplasia in the Rat
Project description:Even though the importance of adequate zinc intake has been known for around half a century, a reliable diagnostic tool to assess the dietary zinc status of individual humans or populations is in absence. The specific aim of this study was to examine differential expression of specific gene transcripts that occur when the dietary intake of zinc is acutely reduced below the dietary requirement for a period of ten days. Gene expression profiles of whole blood collected before and after dietary zinc restriction were determined by microarray analyses. The data provide potential signature genes of suboptimal zinc consumption and relevant bioinformatic interpretation indicate immune response and cell cycle regulation as biological processes associated with the zinc-responsive genes. To identify candidate markers holding the potential to indicate zinc status, a 24-day observational study comprised of acclimation (7 d; 10.4 mg Zn/d), zinc depletion (10 d; 0.3 mg Zn/d), and zinc repletion (7 d; 29.5 mg Zn/d) phases was conducted with healthy male subjects (n = 9). On day 0, 6 and 10 of zinc depletion, whole blood was collectedunder morning fasting state. RNA profiles were stabilized by using PAXgene reagents during the collection process and globin RNA reduction was conducted to improve the detection of transcripts at low abundance. Genes responding to dietary zinc restriction were determined by array results from individual samples collected before and after 10 d of zinc depletion. Pooled RNA samples from each day of blood collection, i.e., baseline, 6 d and 10 d of depletion, respectively, were used to determine the temporal expression pattern of the zinc-responsive genes during dietary zinc depletion.
Project description:Zinc deficiency is detrimental to organisms highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within zebrafish gill. This tissue represents a model system for studying ion absorption across polarised cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Zebrafish were treated with either zinc-depleted (water = 2.61 μg L-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μg L-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Global transcript levels were measured in zebrafish gills using a oligonucleotide array either zinc-depleted or zinc-adequate diet. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array
Project description:To better understand the mechanisms of miRNAs in PUFA-modulated cellular pathways, we compared physical signs and immune statuses of PUFA-treated rats. The results indicated that omega-3 PUFAs decreased production of pro-inflammatory cytokines such as interleukin-6, C-reactive protein, and tumor necrosis factor-a, at the same time, increased proportion of CD8+ suppressor T cells and regulatory T cells in rats. The changes of these biological parameters showed that the PUFA diet-induced autoimmune (AI)-prone and AI-averse rat models were successfully established. As following steps, differentially expressed miRNAs were filtered in peripheral serum by microarray assay and validated in PBMC, liver, visceral fat, and pituitary gland by stem-loop real-time quantitative-PCR (RT-qPCR). Biological databases and computational algorithms were used to classify the potential target genes of these PUFA-induced differentially expressed miRNAs.
Project description:Transcriptional profiling of Saccharomyces cerevisiae cells comparing the W303-1A wildtype with the W303-1A double mutant for MSN2 and MSN4 during zinc deficient conditions Keywords: Genetic modification with zinc limitation Two condition experiment, W303-1A vs W303-1A delta MSN2, MSN4. Biological replicates: 2 wildtype, 2 knock-out, independently grown and harvested.
Project description:Spinal cord injury (SCI) is a devastating and highly heterogeneous condition that often leads to permanent sensory, motor, and autonomic impairments. Beyond the initial mechanical trauma, a cascade of secondary biochemical events further amplifies tissue damage and functional loss. In this study, we investigate the proteomic consequences of the reactive aldehyde acrolein within the context of secondary injury pathology. Using comparative proteomic analyses, we evaluate biomolecular changes in SCI vs sham injury and acrolein vs saline injection models. We then apply integrated computational approaches to identify shared protein alterations and biological pathways that may mechanistically link acrolein exposure to SCI pathology.
Project description:Dietary zinc is routinely supplemented to promote growth, boost the immune system, protect against diabetes or aid recovery from diarrhoea. We exploited the zebrafish (Danio rerio) gill as a unique vertebrate ion transporting epithelium model to study the time-dependent regulatory networks of gene-expression leading to homeostatic control during zinc supplementation. This organ forms a conduit for zinc uptake whilst exhibiting conservation of zinc trafficking components. Fish were maintained with zinc supplemented water (4.0 uM) and diet (2023 mg zinc kg-1) or in un-amended water and diet, containing Zn2+ at 0.25 µM and 233 mg zinc kg-1 respectively. Gill tissues were harvested at five time points (8 hours to 14 days) and transcriptome changes analysed in quintuplicate using a 16K microarray. Global transcript levels were measured in zebrafish gills using a oligonucleotide array either zinc-adequate or zinc-supplemented diet. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.