Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

MRNA expression profiles of TAE-684 treated or shALK transfected neuroblastoma cell lines


ABSTRACT: Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.

ORGANISM(S): Homo Sapiens

SUBMITTER: Katleen De Preter 

PROVIDER: E-MTAB-3205 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

altmetric image

Publications

Upregulation of MAPK Negative Feedback Regulators and RET in Mutant ALK Neuroblastoma: Implications for Targeted Treatment.

Lambertz Irina I   Kumps Candy C   Claeys Shana S   Lindner Sven S   Beckers Anneleen A   Janssens Els E   Carter Daniel R DR   Cazes Alex A   Cheung Belamy B BB   De Mariano Marilena M   De Bondt An A   De Brouwer Sara S   Delattre Olivier O   Gibbons Jay J   Janoueix-Lerosey Isabelle I   Laureys Geneviève G   Liang Chris C   Marchall Glenn M GM   Porcu Michael M   Takita Junko J   Trujillo David Camacho DC   Van Den Wyngaert Ilse I   Van Roy Nadine N   Van Goethem Alan A   Van Maerken Tom T   Zabrocki Piotr P   Cools Jan J   Schulte Johannes H JH   Vialard Jorge J   Speleman Frank F   De Preter Katleen K  

Clinical cancer research : an official journal of the American Association for Cancer Research 20150324 14


<h4>Purpose</h4>Activating ALK mutations are present in almost 10% of primary neuroblastomas and mark patients for treatment with small-molecule ALK inhibitors in clinical trials. However, recent studies have shown that multiple mechanisms drive resistance to these molecular therapies. We anticipated that detailed mapping of the oncogenic ALK-driven signaling in neuroblastoma can aid to identify potential fragile nodes as additional targets for combination therapies.<h4>Experimental design</h4>T  ...[more]

Similar Datasets

2015-05-04 | E-MTAB-3207 | biostudies-arrayexpress
2021-09-10 | PXD024551 | Pride
2015-08-01 | E-GEOD-65233 | biostudies-arrayexpress
2020-11-24 | E-MTAB-9600 | biostudies-arrayexpress
2021-04-14 | E-MTAB-10032 | biostudies-arrayexpress
2017-11-28 | GSE107354 | GEO
2025-08-21 | PXD025208 | Pride
2020-11-24 | E-MTAB-9598 | biostudies-arrayexpress
2023-12-13 | PXD041824 | Pride
2018-09-01 | E-MTAB-6654 | biostudies-arrayexpress