Dataset Information

MiR-150-5p contributes to unexplained recurrent spontaneous abortion by targeting VEGFA and downregulating the PI3K/AKT/mTOR signaling pathway.

ABSTRACT:

Purpose

The purpose of this study is to investigate the function of miR-150-5p in URSA.

Method

Twenty-six chorionic villous tissues were collected to examine the expression of miR-150-5p and VEGFA by using quantitative polymerase chain reaction (qPCR) and western blot assay, respectively. Transwell assay was conducted to assess the migration and invasion ability of trophoblast cells. The dual-luciferase reporter assay was applied to determine the relationship between miR-150-5p and VEGFA in vitro. Relevant signaling pathway protein expression level was measured via western blot assay. Signaling transduction inhibitor LY294002 was used to block PI3K/AKT/mTOR signaling pathway. Finally, in vivo the effect of miR-150-5p on embryonic absorption rate was evaluated in mice.

Results

Clinical samples revealed that miR-150-5p expression was significantly elevated in the villous tissues and serum of URSA patients. Moreover, the overexpressing of miR-150-5p could inhibit both HTR-8/SVneo cell and JAR cell migration, invasion, and restrained PI3K/AKT/mTOR signaling pathway by targeting VEGFA in vitro. This inhibitory effect of miR-150-5p could be reversed by overexpressing the gene of vascular epithelial growth factor A (VEGFA). In contrary, inhibition of miR-150-5p significantly enhanced migration, invasion ability of both HTR-8/SVneo and JAR cells, and also could stimulate PI3K/AKT/mTOR signaling pathway. This promoting effect of miR-150-5p could be ameliorated by LY294002 (PI3K inhibitor). Finally, after miR-150-5p overexpression in vivo, the embryo resorption rate in pregnant mice was increased significantly.

Conclusions

Overall, these findings imply that miR-150-5p is among the key factors that regulate the pathogenesis of URSA.

SUBMITTER: Liao W

PROVIDER: S-EPMC10789717 | biostudies-literature | 2024 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

MiR-150-5p contributes to unexplained recurrent spontaneous abortion by targeting VEGFA and downregulating the PI3K/AKT/mTOR signaling pathway.

Liao Wenyan W Deng Xin X Chen Guodong G Yang Juanli J Li Yi Y Li Li L Zhong Lili L Tao Guangwei G Hou Jiafeng J Li Mujun M Ding Chengming C

Journal of assisted reproduction and genetics 20231103 1

<h4>Purpose</h4>The purpose of this study is to investigate the function of miR-150-5p in URSA.<h4>Method</h4>Twenty-six chorionic villous tissues were collected to examine the expression of miR-150-5p and VEGFA by using quantitative polymerase chain reaction (qPCR) and western blot assay, respectively. Transwell assay was conducted to assess the migration and invasion ability of trophoblast cells. The dual-luciferase reporter assay was applied to determine the relationship between miR-150-5p an ...[more]

PMID: 37921969

Similar Datasets

Project description:BackgroundRecurrent spontaneous abortion (RSA) is defined as two or more consecutive spontaneous abortions before 20 weeks with the same spouse [1]. However, approximately 50% of RSA cases of unknown cause are classified as unexplained recurrent spontaneous abortion (URSA). Potential factors include decreased trophoblast cell migration and invasion, leading to impaired placental implantation and maintenance of the normal maternal-fetal interface. However, the mechanism of this pathogenesis remains unknown. In this study, we investigated the potential role and mechanism of KLF4 in regulating URSA by influencing the invasion and migration ability of trophoblast cells.MethodsWe firstly identified 817 differentially expressed genes by performing a difference analysis of the dataset GSE121950 [2] related to recurrent abortion, and intersected the top 10 genes obtained respectively by the three algorithms: DMNC, MNC, and EPC using Venn Diagram.To detect the expression levels of core genes, villi samples were obtained from normal pregnant women and patients with URSA. RT-qPCR analysis revealed a significant difference in KLF4 mRNA expression and KLF4 was then analyzed. Trophoblast cell lines HTR8 and JEG3 were used to investigate the effect of KLF4 on trophoblastic function. Wound healing and transwell assays was performed to detect the invasion and migration of trophoblast cells. The expression of epithelial-mesenchymal transition(EMT) molecules were detected by RT-qPCR and western blot. Promoter detection and epigenetic modification were detected by chromatin immunoprecipitation (ChIP) assay. Molecular nuclear localization was detected by immunofluorescence and subcellular fractionation. Miscarried mice model was used to study the effects of KLF4 on URSA induced by reduced trophoblast invasion and migration.ResultsKLF4 is highly expressed in the villi of patients with URSA. KLF4 inhibits the expression level of H3R2ME2a in trophoblast cells by regulating the transcriptional level and nuclear translocation of PRMT6, thereby inhibiting the possible regulatory mechanism of trophoblastic invasion and providing a potential treatment strategy for URSA in vivo.ConclusionsThe KLF4/PRMT6/H3R2ME2a axis regulates mechanisms associated with unexplained recurrent spontaneous abortion by regulating trophoblast function.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Dataset Information

MiR-150-5p contributes to unexplained recurrent spontaneous abortion by targeting VEGFA and downregulating the PI3K/AKT/mTOR signaling pathway.

Purpose

Method

Results

Conclusions

Publications

MiR-150-5p contributes to unexplained recurrent spontaneous abortion by targeting VEGFA and downregulating the PI3K/AKT/mTOR signaling pathway.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets