Coagulation factor 2 thrombin receptor promotes malignancy in glioma under SOX2 regulation
Ontology highlight
ABSTRACT:
SUBMITTER: Gao G
PROVIDER: S-EPMC7346046 | biostudies-literature | 2020 Jun
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:UnlabelledEssentials How the Alzheimer's disease (AD) peptide β-amyloid (Aβ) disrupts neuronal function in the disease is unclear. Factor (F) XII initiates blood clotting via FXI, and thrombosis has been implicated in AD. Aβ triggers FXII-dependent FXI and thrombin activation, evidence of which is seen in AD plasma. Aβ-triggered clotting could contribute to neuronal dysfunction in AD and be a novel therapeutic target.SummaryBackground β-Amyloid (Aβ) is a key pathologic element in Alzheimer's disease (AD), but the mechanisms by which it disrupts neuronal function in vivo are not completely understood. AD is characterized by a prothrombotic state, which could contribute to neuronal dysfunction by affecting cerebral blood flow and inducing inflammation. The plasma protein factor XII triggers clot formation via the intrinsic coagulation cascade, and has been implicated in thrombosis. Objectives To investigate the potential for Aβ to contribute to a prothrombotic state. Methods and results We show that Aβ activates FXII, resulting in FXI activation and thrombin generation in human plasma, thereby establishing Aβ as a possible driver of prothrombotic states. We provide evidence for this process in AD by demonstrating decreased levels of FXI and its inhibitor C1 esterase inhibitor in AD patient plasma, suggesting chronic activation, inhibition and clearance of FXI in AD. Activation of the intrinsic coagulation pathway in AD is further supported by elevated fibrin levels in AD patient plasma. Conclusions The ability of Aβ to promote coagulation via the FXII-driven contact system identifies new mechanisms by which it could contribute to neuronal dysfunction and suggests potential new therapeutic targets in AD.
| S-EPMC4870142 | biostudies-literature
Project description:Skeletal muscle myosin (SkM) has been shown to possess procoagulant activity; however, the mechanisms of this coagulation-enhancing activity involving plasma coagulation pathways and factors are incompletely understood. Here, we discovered direct interactions between immobilized SkM and coagulation factor XI (FXI) using biolayer interferometry (Kd = 0.2 nM). In contrast, we show that prekallikrein, a FXI homolog, did not bind to SkM, reflecting the specificity of SkM for FXI binding. We also found that the anti-FXI monoclonal antibody, mAb 1A6, which recognizes the Apple (A) 3 domain of FXI, potently inhibited binding of FXI to immobilized SkM, implying that SkM binds FXI A3 domain. In addition, we show that SkM enhanced FXI activation by thrombin in a concentration-dependent manner. We further used recombinant FXI chimeric proteins in which each of the four A domains of the heavy chain (designated A1 through A4) was individually replaced with the corresponding A domain from prekallikrein to investigate SkM-mediated enhancement of thrombin-induced FXI activation. These results indicated that activation of two FXI chimeras with substitutions of either the A3 domains or A4 domains was not enhanced by SkM, whereas substitution of the A2 domain did not reduce the thrombin-induced activation compared with wildtype FXI. These data strongly suggest that functional interaction sites on FXI for SkM involve the A3 and A4 domains. Thus, this study is the first to reveal and support the novel intrinsic blood coagulation pathway concept that the procoagulant mechanisms of SkM include FXI binding and enhancement of FXI activation by thrombin.
| S-EPMC8856988 | biostudies-literature
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
| S-ECPF-GEOD-51441 | biostudies-other
Project description:Hemostatic defects are treated using coagulation factors; however, clot formation also requires a procoagulant phospholipid (PL) surface. Here, we show that innate immune cell-derived enzymatically oxidized phospholipids (eoxPL) termed hydroxyeicosatetraenoic acid-phospholipids (HETE-PLs) restore hemostasis in human and murine conditions of pathological bleeding. HETE-PLs abolished blood loss in murine hemophilia A and enhanced coagulation in factor VIII- (FVIII-), FIX-, and FX-deficient human plasma . HETE-PLs were decreased in platelets from patients after cardiopulmonary bypass (CPB). To explore molecular mechanisms, the ability of eoxPL to stimulate individual isolated coagulation factor/cofactor complexes was tested in vitro. Extrinsic tenase (FVIIa/tissue factor [TF]), intrinsic tenase (FVIIIa/FIXa), and prothrombinase (FVa/FXa) all were enhanced by both HETE-PEs and HETE-PCs, suggesting a common mechanism involving the fatty acid moiety. In plasma, 9-, 15-, and 12-HETE-PLs were more effective than 5-, 11-, or 8-HETE-PLs, indicating positional isomer specificity. Coagulation was enhanced at lower lipid/factor ratios, consistent with a more concentrated area for protein binding. Surface plasmon resonance confirmed binding of FII and FX to HETE-PEs. HETE-PEs increased membrane curvature and thickness, but not surface charge or homogeneity, possibly suggesting increased accessibility to cations/factors. In summary, innate immune-derived eoxPL enhance calcium-dependent coagulation factor function, and their potential utility in bleeding disorders is proposed.
| S-EPMC5926910 | biostudies-literature
Project description:The high-mobility group-box transcription factor sex-determining region Y-box 2 (Sox2) is essential for the maintenance of stem cells from early development to adult tissues. Sox2 can reprogram differentiated cells into pluripotent cells in concert with other factors and is overexpressed in various cancers. In glioblastoma (GBM), Sox2 is a marker of cancer stemlike cells (CSCs) in neurosphere cultures and is associated with the proneural molecular subtype. Here, we report that Sox2 expression pattern in GBM tumors and patient-derived mouse xenografts is not restricted to a small percentage of cells and is coexpressed with various lineage markers, suggesting that its expression extends beyond CSCs to encompass more differentiated neoplastic cells across molecular subtypes. Employing a CSC derived from a patient with GBM and isogenic differentiated cell model, we show that Sox2 knockdown in the differentiated state abolished dedifferentiation and acquisition of CSC phenotype. Furthermore, Sox2 deficiency specifically impaired the astrocytic component of a biphasic gliosarcoma xenograft model while allowing the formation of tumors with sarcomatous phenotype. The expression of genes associated with stem cells and malignancy were commonly downregulated in both CSCs and serum-differentiated cells on Sox2 knockdown. Genes previously shown to be associated with pluripontency and CSCs were only affected in the CSC state, whereas embryonic stem cell self-renewal genes and cytokine signaling were downregulated, and the Wnt pathway activated in differentiated Sox2-deficient cells. Our results indicate that Sox2 regulates the expression of key genes and pathways involved in GBM malignancy, in both cancer stemlike and differentiated cells, and maintains plasticity for bidirectional conversion between the two states, with significant clinical implications.
| S-EPMC4094829 | biostudies-literature
Project description:BackgroundThe variability in bleeding patterns among individuals with hemophilia A, who have similar factor VIII (FVIII) levels, is significant and the origins are unknown.ObjectiveTo use a previously validated mathematical model of flow-mediated coagulation as a screening tool to identify parameters that are most likely to enhance thrombin generation in the context of FVIII deficiency.MethodsWe performed a global sensitivity analysis (GSA) on our mathematical model to identify potential modifiers of thrombin generation. Candidates from the GSA were confirmed by calibrated automated thrombography (CAT) and flow assays on collagen-tissue factor (TF) surfaces at a shear rate of 100 per second.ResultsSimulations identified low-normal factor V (FV) (50%) as the strongest modifier, with additional thrombin enhancement when combined with high-normal prothrombin (150%). Low-normal FV levels or partial FV inhibition (60% activity) augmented thrombin generation in FVIII-inhibited or FVIII-deficient plasma in CAT. Partial FV inhibition (60%) boosted fibrin deposition in flow assays performed with whole blood from individuals with mild and moderate FVIII deficiencies. These effects were amplified by high-normal prothrombin levels in both experimental models.ConclusionsThese results show that low-normal FV levels can enhance thrombin generation in hemophilia A. Further explorations with the mathematical model suggest a potential mechanism: lowering FV reduces competition between FV and FVIII for factor Xa (FXa) on activated platelet surfaces (APS), which enhances FVIII activation and rescues thrombin generation in FVIII-deficient blood.
| S-EPMC6994344 | biostudies-literature
Project description:BackgroundFactor XII (FXII) activation initiates the intrinsic (contact) coagulation pathway. It has been recently suggested that FXII could act as an autoimmunity mediator in multiple sclerosis (MS). FXII depositions nearby dentritic cells were detected in the central nervous system of MS patients and increased FXII activity has been reported in plasma of relapsing remitting and secondary progressive MS patients. FXII inhibition has been proposed to treat MS.ObjectiveTo investigate in MS patients multiple FXII-related variables, including the circulating amount of protein, its pro-coagulant function, and their variation over time. To explore kinetic activation features of FXII in thrombin generation (TG).MethodsIn plasma from 74 MS patients and 49 healthy subjects (HS), FXII procoagulant activity (FXII:c) and FXII protein (FXII:Ag) levels were assessed. Their ratio (FXII:ratio) values were derived. Intrinsic TG was evaluated by different triggers.ResultsHigher FXII:Ag levels (p = 0.003) and lower FXII:ratio (p < 0.001) were detected in MS patients compared with HS. FXII variables were highly correlated over four time points, which supports investigation of FXII contribution to disease phenotype and progression. A significant difference over time was detected for FXII:c (p = 0.031). In patients selected for the lowest FXII:ratio, TG triggered by ellagic acid showed a trend in lower endogenous thrombin potential (ETP) in MS patients compared with HS (p = 0.042). Intrinsic triggering of TG by nucleic acid addition produced longer time parameters in patients than in HS and substantially increased ETP in MS patients (p = 0.004) and TG peak height in HS (p = 0.008). Coherently, lower FXII:ratio and longer lag time (p = 0.02) and time to peak (p = 0.007) point out a reduced response of FXII to activation in part of MS patients.ConclusionIn MS patients, factor-specific and modified global assays suggest the presence of increased FXII protein level and reduced function within the intrinsic coagulation pathway. These novel findings support further investigation by multiple approaches of FXII contribution to disease phenotype and progression.
| S-EPMC5919941 | biostudies-literature
Project description:Monocarboxylate transporter 4 (MCT4, SLC16A3) is elevated under hypoxic conditions in many malignant tumors including gliomas. Moreover, MCT4 expression is associated with shorter overall survival. However, the functional consequences of MCT4 expression on the distinct hallmarks of cancer have not yet been explored at the cellular level. Here, we investigated the impact of MCT4 overexpression on proliferation, survival, cell death, migration, invasion, and angiogenesis in F98 glioma cells. Stable F98 glioma cell lines with MCT4 overexpression, normal expression, and knockdown were generated. Distinct hallmarks of cancer were examined using in silico analysis, various in vitro cell culture assays, and ex vivo organotypic rat brain slice culture model. Consistent with its function as lactate and proton exporter, MCT4 expression levels correlated inversely with extracellular pH and proportionally with extracellular lactate concentrations. Our results further indicate that MCT4 promotes proliferation and survival by altered cell cycle regulation and cell death mechanisms. Moreover, MCT4 overexpression enhances cell migration and invasiveness via reorganization of the actin cytoskeleton. Finally, MCT4 inhibition mitigates the induction of angiogenesis, suggesting that MCT4 also plays a crucial role in tumor-related angiogenesis. In summary, our data highlight MCT4/SLC16A3 as a key gene for distinct hallmarks of tumor malignancy in glioma cells.
| S-EPMC8060090 | biostudies-literature
Project description:ObjectiveCardiac myosin (CM) is structurally similar to skeletal muscle myosin, which has procoagulant activity. Here, we evaluated CM's ex vivo, in vivo, and in vitro activities related to hemostasis and thrombosis. Approach and Results: Perfusion of fresh human blood over CM-coated surfaces caused thrombus formation and fibrin deposition. Addition of CM to blood passing over collagen-coated surfaces enhanced fibrin formation. In a murine ischemia/reperfusion injury model, exogenous CM, when administered intravenously, augmented myocardial infarction and troponin I release. In hemophilia A mice, intravenously administered CM reduced tail-cut-initiated bleeding. These data provide proof of concept for CM's in vivo procoagulant properties. In vitro studies clarified some mechanisms for CM's procoagulant properties. Thrombin generation assays showed that CM, like skeletal muscle myosin, enhanced thrombin generation in human platelet-rich and platelet-poor plasmas and also in mixtures of purified factors Xa, Va, and prothrombin. Binding studies showed that CM, like skeletal muscle myosin, directly binds factor Xa, supporting the concept that the CM surface is a site for prothrombinase assembly. In tPA (tissue-type plasminogen activator)-induced plasma clot lysis assays, CM was antifibrinolytic due to robust CM-dependent thrombin generation that enhanced activation of TAFI (thrombin activatable fibrinolysis inhibitor).ConclusionsCM in vitro is procoagulant and prothrombotic. CM in vivo can augment myocardial damage and can be prohemostatic in the presence of bleeding. CM's procoagulant and antifibrinolytic activities likely involve, at least in part, its ability to bind factor Xa and enhance thrombin generation. Future work is needed to clarify CM's pathophysiology and its mechanistic influences on hemostasis or thrombosis.
| S-EPMC7135739 | biostudies-literature
Project description:The acidic tumor microenvironment provides an energy source driving malignant tumor progression. Adaptation of cells to an acidic environment leads to the emergence of cancer stem cells. The expression of the vitamin D receptor (VDR) is closely related to the initiation and development of colorectal carcinoma (CRC), but its regulatory mechanism in CRC stem cells is still unclear. Our study revealed that acidosis reduced VDR expression by downregulating peroxisome proliferator-activated receptor delta (PPARD) expression. Overexpression of VDR effectively suppressed the stemness and oxaliplatin resistance of cells in acidosis. The nuclear export signal in VDR was sensitive to acidosis, and VDR was exported from the nucleus. Chromatin immunoprecipitation (ChIP) and assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) analyses showed that VDR transcriptionally repressed SRY-box 2 (SOX2) by binding to the vitamin D response elements in the promoter of SOX2, impairing tumor growth and drug resistance. We demonstrated that a change in the acidic microenvironment combined with overexpression of VDR substantially restricted the occurrence and development of CRC in vivo. These findings reveal a new mechanism by which acidosis could affect the stemness of CRC cells by regulating the expression of SOX2 and show that abnormal VDR expression leads to ineffective activation of vitamin D signaling, resulting in a lack of efficacy of vitamin D in antineoplastic process.
| S-EPMC7479104 | biostudies-literature