Dataset Information

Correlation between unexplained recurrent spontaneous abortion with CD4+CD25+ regulatory T-cell and killer cell immunoglobulin-like receptor levels.

ABSTRACT: The present study investigated the correlation between unexplained recurrent spontaneous abortion (URSA) with CD4+CD25+ regulatory T-cell (Treg) and killer cell immunoglobulin-like receptor (KIR)-2DL1 levels. A total of 76 URSA patients were enrolled (35 without pregnancy, Group A, and 41 with early abortion, Group B). Additionally, 30 patients who received a regular abortion as planned (Group C) and 30 healthy volunteers (Group D) were selected. Peripheral venous blood and fresh decidual tissue samples were obtained from all the patients, and flow cytometry was performed to detect CD4+CD25+Treg and Foxp3 transcription factor levels. mRNA and protein KIR-2DL1 expression levels were assayed using quantitative PCR and western blot analysis, respectively. No statistically significant differences in peripheral venous blood CD4+CD25+Treg/CD4+ and Foxp3+/CD4+CD25+Treg cell proportions were found among the groups (P>0.05). However, the decidual tissues of Group C presented significantly higher levels of both cell types versus other groups (P<0.05). No statistically significant differences were found in comparisons among Groups A, B, and D (P>0.05). In peripheral venous blood, mRNA and protein KIR-2DL1 expression levels in Group C were significantly higher than those in the other three groups (P<0.05), but again, there were no statistically significant differences among Groups A, B, and D (P>0.05). In decidual tissues, KIR-2DL1 levels were significantly higher in Group C relative to Groups A, B, and D (P<0.05). Decreased CD4+CD25+Treg counts and KIR-2DL1 expression levels were closely associated with the onset of URSA. CD4+CD25+Tregs mainly exert their effects on decidual tissues, while KIR-2DL1 can act on peripheral venous blood and decidual tissues. These may present new targets for early intervention in URSA.

SUBMITTER: Quan X

PROVIDER: S-EPMC5526191 | biostudies-other | 2017 Aug

REPOSITORIES: biostudies-other

ACCESS DATA

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Project description:BackgroundRecurrent spontaneous abortion (RSA) is defined as two or more consecutive spontaneous abortions before 20 weeks with the same spouse [1]. However, approximately 50% of RSA cases of unknown cause are classified as unexplained recurrent spontaneous abortion (URSA). Potential factors include decreased trophoblast cell migration and invasion, leading to impaired placental implantation and maintenance of the normal maternal-fetal interface. However, the mechanism of this pathogenesis remains unknown. In this study, we investigated the potential role and mechanism of KLF4 in regulating URSA by influencing the invasion and migration ability of trophoblast cells.MethodsWe firstly identified 817 differentially expressed genes by performing a difference analysis of the dataset GSE121950 [2] related to recurrent abortion, and intersected the top 10 genes obtained respectively by the three algorithms: DMNC, MNC, and EPC using Venn Diagram.To detect the expression levels of core genes, villi samples were obtained from normal pregnant women and patients with URSA. RT-qPCR analysis revealed a significant difference in KLF4 mRNA expression and KLF4 was then analyzed. Trophoblast cell lines HTR8 and JEG3 were used to investigate the effect of KLF4 on trophoblastic function. Wound healing and transwell assays was performed to detect the invasion and migration of trophoblast cells. The expression of epithelial-mesenchymal transition(EMT) molecules were detected by RT-qPCR and western blot. Promoter detection and epigenetic modification were detected by chromatin immunoprecipitation (ChIP) assay. Molecular nuclear localization was detected by immunofluorescence and subcellular fractionation. Miscarried mice model was used to study the effects of KLF4 on URSA induced by reduced trophoblast invasion and migration.ResultsKLF4 is highly expressed in the villi of patients with URSA. KLF4 inhibits the expression level of H3R2ME2a in trophoblast cells by regulating the transcriptional level and nuclear translocation of PRMT6, thereby inhibiting the possible regulatory mechanism of trophoblastic invasion and providing a potential treatment strategy for URSA in vivo.ConclusionsThe KLF4/PRMT6/H3R2ME2a axis regulates mechanisms associated with unexplained recurrent spontaneous abortion by regulating trophoblast function.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.