Project description:Embryos were injected with either control or Smicl antisense morpholino oligonucleotides and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis
Project description:Embryos were injected with either control or Activin antisense morpholino oligonucleotides and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis
Project description:Embryos were injected with antisense Morpholino Oligonucleotides (AMOs) targetting MyoD. The transcriptional profile of these knock down embryos was compared with embryos injected with control morpholino (CMO).
Project description:Embryos were injected with either control or Smicl antisense morpholino oligonucleotides and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis Embryos from three different spawnings where injected at one cell stage with either control or Smicl antisense morpholino oligonucleotides and cultured to early gastrula stage 10.5 for RNA isolation. Some embryos were cultured to further development to check their phenotypes. Each slide was hybridised with a mixture 1:1 of sample and control cDNAs, each labelled with a different dye. Hybridisations were carried out as dye-swapped technical replicates, therefore six microarray slides were hybridized
Project description:Xenopus laevis embryos were injected with antisense oligonucleotides against TBP, TLF or TBP2. Embryos were allowed to develop up to stage 7 (non-injected control embryos) or stage 10.5 (early gastrula, control and antisense injected embryos) and subsequently collected for RNA and protein isolation. The transcriptome profile of antisense injected and control embryos was compared.
Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
Project description:Transcriptional profiling of embryonic zebrafish injected with a control morpholino or a morpholino that causes exclusion of TNNT2 exon 13. Zebrafish embryos were injected with a antisense morpholino oligo that induced missplicing of exon 13 of TNNT2 (TNNT2sp) or a control morpholino. At 96hpf these embryos were euthanized and RNA was collected.
Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555
Project description:Transcriptional profiling of hdac1 ATG morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG) or Standard control morpholino (StCo). RNA was extracted at 12, 18 and 27hpf from both sets of embryos and compared with a two-colour hybridisation.
