Ontology highlight
ABSTRACT:
PROVIDER: PRJEB18925 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Illumina MiSeq high-throughput sequencing Raw sequence reads
| PRJNA588632 | ENA
Project description:Purpose: To understanding the effects of RORa deficiency on ILC1 cells, we conducted bulk mRNA-seqencing Method: Firstly, we purified liver ILC1 cells (CD45.2+CD3-CD19-NKp46+NK1.1+CD49a+CD49b-) via Fluorescence Activated Cell Sorting, then frozen in -80 °C ultra-low temperature refrigerator, followed by High-throughput sequencing, in three replicates for WT (Rorafl/fl) mice and one replicate for cKO (Ncr1Cre-Rorafl/fl) , using Illumina Hiseq 1500 platform.
2022-09-28 | GSE186193 | GEO
Project description:<p>Vaccine development against <i>Salmonella enterica</i> serovar Typhi (<i>S</i>. Typhi) requires a better understanding of interaction between human host and the resident microbial consortia in gastrointestinal tract. Healthy adult volunteers received either Ty21a, M01ZH09 or placebo, and underwent challenges with wt <i>S</i>. Typhi. Stool samples were collected at the screening interview (Baseline 1), prior to the first vaccination visit (Baseline 2), during vaccination (Day -28 and -26 for placebo and M01ZH09 groups; Day -32, -30, -28, -26 for Ty21a group), prior to challenge with <i>S</i>. Typhi (Day 0), and after challenge (day 0 12h, day 1, day 3, day 7, and day 10). 16S rRNA and messenger RNA were extracted from stool and sequenced on the Illumina Miseq and HiSeq 2000 platforms, respectively.</p>
| phs001521 | dbGaP
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long term metal pollution. Studying twelve sites located along two distinct gradients of metal pollution in Southern Poland revealed that both community composition (via MiSeq Illumina sequencing of 16S rRNA genes) and functional gene potential (using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level significantly impacted microbial community structure (p = 0.037), but not bacterial taxon richness. Metal pollution altered the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal resistance genes showed significant correlations with metal concentrations in soil, although no clear impact of metal pollution levels on overall functional diversity and structure of microbial communities was observed. While screens of phylogenetic marker genes, such as 16S rRNA, provided only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appeared to be a more promising strategy. This study showed that the effect of metal pollution on soil microbial communities was not straightforward, but could be filtered out from natural variation and habitat factors by multivariate statistical analysis and spatial sampling involving separate pollution gradients.
2014-07-22 | GSE59620 | GEO
Project description:Global warming has shifted climate zones poleward or upward. However, understanding the responses and mechanism of microbial community structure and functions relevant to natural climate zone succession is challenged by the high complexity of microbial communities. Here, we examined soil microbial community in three broadleaved forests located in the Wulu Mountain (WLM, temperate climate), Funiu Mountain (FNM, at the border of temperate and subtropical climate zones), or Shennongjia Mountain (SNJ, subtropical climate).Soils were characterized for geochemistry, Illumina sequencing was used to determine microbial taxonomic communities and GeoChips 5.0 were used to determine microbial functional genes.
2017-01-10 | GSE92233 | GEO
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
2016-01-01 | GSE73842 | GEO
Project description:The Illumina sequencing systems demonstrate high efficiency and power and remain the most popular platforms. Platforms with similar throughput and quality profiles but lower costs are under intensive development. In this study, we compared two platforms Illumina NextSeq 2000 and GeneMind Genolab M for 10x Genomics Visium spatial transcriptomics.
2023-03-13 | GSE227019 | GEO