Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS).
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards.
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
Project description:High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute protein members can pinpoint microRNA target sites within tens of bases, but leaves the identity of the microRNA unresolved. A flexible computational framework that integrates sequence with cross-linking features reliably identifies the microRNA family involved in each binding event, considerably outperforms sequence-only approaches, and quantifies the prevalence of noncanonical binding modes. Ago2 (Argonaute 2) PAR-CLIP and RNA deep sequencing of Epstein-Barr virus B95.8-infected Lymphoblastoid Cell Lines (LCLs)
Project description:miRNA and other forms of small RNA are now known to regulate many biological processes, and miRNA profiling is already used biomedically for cancer diagnosis, staging, progression, prognosis, and to evaluate responsivity to treatment. However, there is no robust analytical method capable of dissecting the individual miRNA expression profiles from the highly heterogeneous cells comprising tumor samples. Here, we developed parallel single cell small RNA sequencing (PSCSR-seq), which enables highly sensitive and high-throughput miRNA expression profiling of individual cells. We applied PSCSR-seq to examine the small RNA profiles from large numbers of cultured cancer cells, human PBMCs, and from a tumor in a melanoma mouse model. We anticipate that PSCSR-seq can be broadly applied for small RNA analysis in cancer research and more generally in life science.
