Mus musculus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA145939 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:While the core subunits of Polycomb group (PcG) complexes are well characterized, little is known about the dynamics of these protein complexes during cellular differentiation. We used quantitative interaction proteomics to study PcG proteins in mouse embryonic stem cells (mESCs) and neural progenitor cells (NPCs). We found the stoichiometry of PRC1 and PRC2 to be highly dynamic during neural differentiation.
2016-05-19 | PXD003758 | Pride
Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells.
2014-08-02 | GSE60003 | GEO
Project description:Polycomb group (PcG) proteins are essential for accurate axial body patterning during embryonic development. PcG-mediated repression is conserved in metazoans and is targeted in Drosophila by Polycomb response elements (PREs). Targeting sequences in humans have not been described. While analyzing chromatin architecture in the context of human embryonic stem cell (hESC) differentiation, we discovered a 1.8kb region between HOXD11 and HOXD12 (D11.12) that is associated with PcG proteins, is nuclease hypersensitive, and shows alteration as hESCs differentiate. D11.12 repressed luciferase expression from a reporter construct both before and after differentiation of mesenchymal stem cells into adipocytes. Full repression by D11.12 required a highly conserved region and YY1 binding sites. Repression relied upon PcG proteins Bmi1 and Eed and a YY1-interacting partner, RYBP. We conclude that D11.12 is a Polycomb-dependent regulatory region with similarities to Drosophila PREs, indicating conservation in the mechanisms that target PcG function in mammals and flies. Data contains microarray measurements of the MNase-digested mononucleosomal fragments in hES cells, derived MSCs, osteoblasts and adipocytes. The ChIP-chip data includes Suz12, Bmi1 and H3K27me3 measurements in MSCs and adipocytes.
2010-06-19 | E-GEOD-19046 | biostudies-arrayexpress
Project description:The Polycomb group protein CBX6 is an essential regulator of embryonic stem cell identity
| PRJNA386280 | ENA
Project description:Polycomb group (PcG) proteins are required for normal differentiation and development, and their activity is found deregulated in cancer. PcG proteins are involved in gene silencing, however, whether they initiate or maintain transcriptional repression is a subject of debate. Here, we show that knockout of the Polycomb repressive complex 2 (PRC2) does not lead to significant gene expression changes in mouse embryonic stem cells (mESCs), and that it is dispensable for initiating silencing of target genes during differentiation. Transcriptional inhibition in mESCs is sufficient to induce genome-wide ectopic PRC2 recruitment to endogenous PcG target genes found in other tissues. PRC2 binding analysis shows that it is restricted to nucleosome-free CpG islands (CGIs) of un-transcribed genes. Our results show that it is the transcriptional state that governs PRC2 binding, and we propose that it binds by default to non-transcribed CGI genes to maintain their silenced state and to protect cell identity. RNA-seq time-course experiments during in vitro differentiation (0h, 24h, 48h and 72h) of Mus musculus wild-type E14 and Suz12 knock-out Embryonic Stem Cells with two biological replicates per condition.
2014-07-03 | E-GEOD-58017 | biostudies-arrayexpress
Project description:Polycomb group (PcG) proteins are required for normal differentiation and development, and their activity is found deregulated in cancer. PcG proteins are involved in gene silencing, however, whether they initiate or maintain transcriptional repression is a subject of debate. Here, we show that knockout of the Polycomb repressive complex 2 (PRC2) does not lead to significant gene expression changes in mouse embryonic stem cells (mESCs), and that it is dispensable for initiating silencing of target genes during differentiation. Transcriptional inhibition in mESCs is sufficient to induce genome-wide ectopic PRC2 recruitment to endogenous PcG target genes found in other tissues. PRC2 binding analysis shows that it is restricted to nucleosome-free CpG islands (CGIs) of un-transcribed genes. Our results show that it is the transcriptional state that governs PRC2 binding, and we propose that it binds by default to non-transcribed CGI genes to maintain their silenced state and to protect cell identity. Suz12, H3K27me3 and RNAPII ChIP-seq experiments before and after transcriptional inhibition with either DRB (0h, 6h and 12h) or Triptolide (0h, 3h and 9h) treatment of Mus musculus wild-type E14 Embryonic Stem Cells with up to two biological replicates per condition.
2014-07-03 | E-GEOD-58019 | biostudies-arrayexpress
Project description:Elucidating how chromatin organization influences gene expression patterns and ultimately cell fate is fundamental to understanding development and disease. Histone variants have emerged as key regulators of genome function by creating specialized chromatin domains. The histone variant H2AZ plays an essential, but poorly understood function during early mammalian development. Genome-wide analysis reveals that H2AZ is enriched at a large class of developmentally important genes that are known targets of Polycomb-mediated repression in embryonic stem (ES) cells. H2AZ displays a highly defined spatial patterning that is remarkably similar to the Polycomb group (PcG) protein Suz12 in ES cells, but not in differentiated cell types. By using RNA interference, we demonstrate that H2AZ is a critical regulatory component at developmental genes in ES cells and show that localization of H2AZ and PcG proteins is interdependent at target promoters. Moreover, similarly to Suz12, H2AZ is required for lineage commitment. This study reveals a connection between H2AZ and PcG proteins in ES cells and suggests that these factors functionally interact to regulate chromatin states necessary for the proper execution of developmental gene expression programs.
2009-01-22 | E-TABM-556 | biostudies-arrayexpress
Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.
2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress
Project description:LUM1_676443: human, purified fusion protein EZH1-SUZ12. For studying phosphorylation of serine 583 on human SUZ12.
LUM1_679396: mouse, antibody IP of mouse embryonic stem cells. For studying phosphorylation of serine 585 on mouse SUZ12.
2022-01-14 | MSV000088683 | MassIVE
Project description:Polycomb group proteins are essential for early development in metazoans but their contributions to human development are not yet well understood. We have mapped the Polycomb Repressive Complex 2 (PRC2) subunit Suz12 across the entire non-repeat portion of the genome in human embryonic stem (ES) cells. We found that Suz12 is distributed across large portions of over two hundred genes encoding key developmental regulators. These genes are occupied by nucleosomes trimethylated at histone H3K27, are transcriptionally repressed, and contain some of the most highly conserved non-coding elements in the vertebrate genome. We found that preferential activation of PRC2 target genes occurs during differentiation of ES cells into other cell types. The ES cell transcriptional regulators Oct4, Sox2 and Nanog co-occupied a significant subset of these genes, further supporting a link between repression of developmental regulators and stem cell pluripotency. These results indicate that PRC2 occupies a special set of developmental genes in ES cells that must be repressed to maintain pluripotency and that are poised for activation during ES cell differentiation.
2006-06-14 | E-WMIT-7 | biostudies-arrayexpress