Specific inhibition of splicing factor activity by decoy RNA oligonucleotides
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA522237 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.
2019-01-31 | PXD012564 | Pride
Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.
2019-02-14 | GSE126503 | GEO
Project description: Not available
| S-EPMC6453957 | biostudies-literature
Project description:The occurrence of extensive cryptic splicing following the depletion of nuclear TDP-43 results in impaired neuronal function and degeneration. Here, we show that oligonucleotides containing CA-repeat sequences can mimic TDP-43 pre-mRNA binding and broadly repress cryptic splicing events, reverse protein loss, and restore neuronal activity in TDP-43-depleted neurons. Our results indicate that (CA)n oligonucleotides are potential therapeutic agents to address global mis-splicing in TDP-43 proteinopathies.
2023-12-23 | GSE250255 | GEO
Project description:The occurrence of extensive cryptic splicing following the depletion of nuclear TDP-43 results in impaired neuronal function and degeneration. Here, we show that oligonucleotides containing CA-repeat sequences can mimic TDP-43 pre-mRNA binding and broadly repress cryptic splicing events, reverse protein loss, and restore neuronal activity in TDP-43-depleted neurons. Our results indicate that (CA)n oligonucleotides are potential therapeutic agents to address global mis-splicing in TDP-43 proteinopathies.
2023-12-23 | GSE245513 | GEO
Project description:The human Factor VIII (F8) protein is essential for the blood coagulation cascade and specific F8 mutations cause the rare bleeding disorder Hemophilia A (HA). Here, we investigated the impact of HA-causing single-nucleotide mutations on F8 pre-mRNA splicing. We found that 14/97 (∼14.4%) coding sequence mutations tested in our study induced exon skipping. Splicing patterns of 4/11 (∼36.4%) F8 exons tested were especially sensitive to the presence of common disease-causing mutations. RNA-chemical probing analyses revealed a three-way junction structure at the 3′ end of intron 15 (TWJ-3-15). TWJ-3-15 sequesters the polypyrimidine tract, a key determinant of 3′ splice site strength. Using exon-16 of the F8 gene as a model, we designed specific antisense oligonucleotides (ASOs) that target TWJ-3-15 and identified three that promote the splicing of F8 exon-16. Interaction of TWJ-3-15 with ASOs increases accessibility of the polypyrimidine tract and inhibits the binding of hnRNPA1-dependent splicing silencing factors. Moreover, ASOs targeting TWJ-3-15 rescue diverse splicing-sensitive HA-causing mutations, most of which are distal to the 3’ splice site being impacted. The TWJ-3-15 structure and its effect on mRNA splicing provide a model for HA etiology in patients harboring specific F8 mutations and provide a framework for precision RNA-based HA therapies.
2024-01-17 | GSE230495 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Cyclin-dependent kinase 9 (CDK9) phosphorylates RNA polymerase II to promote productive transcription elongation and the phosphorylation also regulates recruitment of the splicing machinery. Here we show that acute CDK9 inhibition affects splicing of thousands of mRNAs. CDK9 inhibition impairs global splicing and there is no evidence for a coordinated response between alternative splicing and the overall transcriptome. Alternative splicing is feature of aggressive prostate cancer (CRPC) and enables generation of an anti-androgen resistant version of a ligand-independent androgen receptor, AR-v7. We show that CDK9 inhibition compromises splicing of the androgen receptor (AR) mRNA due to the faulty utilization of alternative 3’splice site and introduction of premature stop codon. Consequently, this defective splicing results in the loss of AR and AR-v7 expression in models of CRPC. We show that CDK9 expression increases as PC cells develop CRPC-phenotype both in vitro and also in patient samples.
2022-01-10 | GSE169090 | GEO
Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.
2009-11-04 | GSE18844 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO