Ruminiclostridium cellulolyticum
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA554628 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:DNA targeting by Clostridium cellulolyticum CRISPR Cas9 Type II-C system
| PRJNA554604 | ENA
Project description:Clostridium cellulolyticum overview
| PRJNA35941 | ENA
Project description:Genome-wide maps of primary and processed start-sites of transcripts revealed mechanism controlling in vivo stoichiometry of protein complex in bacteria
| PRJNA247408 | ENA
Project description:CRISPR-Cas is an RNA-based defense system that enables prokaryotes to recognize invading foreign DNA by cognate crRNA guides and destroy it by CRISPR-associated Cas nucleases 1,2 . Elucidation of the interference mechanism of the Streptococcus pyogenes Type II CRISPR- Cas9 system has allowed for the successful repurposing of SpCas9 as a generic genome editing tool, with great promise for human gene therapy 3 . However, especially for therapeutic applications, some caution seems appropriate, because Cas9 systems from some human pathogens may induce a cytotoxic response via an unknown mechanism 4 . Here we show that when released in human cells, Cas9 nucleases from the pathogenic bacteria Campylobacter jejuni and S. pyogenes have the potential to cause severe DNA damage. In the absence of a CRISPR RNA guide, native Cas9 nucleases from both pathogens enter the host nucleus, where their presence leads to promiscuous double stranded DNA breaks (DSBs) and induction of cell death. DSB induction can be reduced to background levels either by saturation of CjCas9 and SpCas9 with crRNA guides or by inactivating their nuclease activity. Our results demonstrate that guide-free Cas9 of bacterial pathogens might play an important role in pathogenicity. Furthermore, we propose that saturating Cas9 with appropriate guide RNAs is crucial for efficient and safe therapeutic applications.
2022-03-02 | PXD006712 | Pride
Project description:Cellulose degrading anaerobe
| PRJNA17419 | ENA
Project description:Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.
2018-06-04 | E-MTAB-6808 | biostudies-arrayexpress
Project description: Not available
| S-EPMC4780118 | biostudies-literature
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Transcriptome profiles for Clostridium thermocellum ATCC 27405 wild type strain and two ethanol-adapted strains, E50A and E50C were generated to gain insights into ethanol tolerance. Details of the strains have been described, Shao X., et al. Appl Microbiol Biotechnol (2011) 92:641–652.
2018-03-31 | GSE77089 | GEO
Project description:Ruminiclostridium thermocellum DSM 1313 strain adhE*(EA) expression was studied along with ∆hydG and ∆hydG∆ech mutants strains deposited under GSE54082. All strains have been described in a study entitled Elimination of hydrogenase post-translational modification blocks H2 production and increases ethanol yield in Clostridium thermocellum. Biswas, et .al. Biotechnology for Biofuels 2015 8:20 Ruminiclostridium (Clostridium) thermocellum is a leading candidate organism for implementing a consolidated bioprocessing (CBP) strategy for biofuel production due to its native ability to rapidly consume cellulose and its existing ethanol production pathway. C. thermocellum converts cellulose and cellobiose to lactate, formate, acetate, H2, ethanol, amino acids, and other products. Elimination of the pathways leading to products such as H2 could redirect carbon flux towards ethanol production. Rather than delete each hydrogenase individually, we targeted a hydrogenase maturase gene (hydG), which is involved in converting the three [FeFe] hydrogenase apoenzymes into holoenzymes by assembling the active site. This functionally inactivated all three Fe-Fe hydrogenases simultaneously, as they were unable to make active enzymes. In the ∆hydG mutant, the [NiFe] hydrogenase-encoding ech was also deleted to obtain a mutant that functionally lacks all hydrogenase. The ethanol yield increased nearly 2-fold in ∆hydG∆ech compared to wild type, and H2 production was below the detection limit. Interestingly, ∆hydG and ∆hydG∆ech exhibited improved growth in the presence of acetate in the medium. Transcriptomic and proteomic analysis reveal that genes related to sulfate transport and metabolism were up-regulated in the presence of added acetate in ∆hydG, resulting in altered sulfur metabolism. Further genomic analysis of this strain revealed a mutation in the bi-functional alcohol/aldehyde dehydrogenase adhE gene, resulting in a strain with both NADH- and NADPH-dependent alcohol dehydrogenase activities, whereas the wild type strain can only utilize NADH. This is the exact same adhE mutation found in ethanol-tolerant C. thermocellum strain E50C, but ∆hydG∆ech is not more ethanol tolerant than the wild type. Targeting protein post-translational modification is a promising new approach to target multiple enzymes simultaneously for metabolic engineering. This GEO study pertains to expression profiles generated for C. thermocellum DSM 1313 strain adhE*(EA)
2017-02-01 | GSE77273 | GEO