Project description:We report the application of DNA sequencing technology for high-throughput sequencing of mix bis-PCR products totally 38 based on bisulfate treated DNA from human, chimpanzee, gibbon, macaque and crab eating macaque profrontal cortex tissues. Mix bisulfate PCR products from 1 tissues, 23 individula humans, 2 individual chimpanzees, 1 individual gibbons, 7 individual rhesus macaques and 5 crab eating macaques were sequenced by using MiSeq
Project description:We report the application of DNA sequencing technology for high-throughput sequencing of mix candidate genes' PCR products totally 38 based on DNA from human, chimpanzee, gibbon, macaque and crab eating macaque profrontal cortex tissues. Mix candidate genes PCR products from 1 tissues, 22 individual humans, 2 individual chimpanzees, 1 individual gibbons,15 individual rhesus macaques and 5 crab eating macaques were sequenced by using MiSeq
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:We report the genome-wide small RNA of soybean early maturation seed coat parenchyma compartment soybean early maturation seeds using Illumina high-throughput sequencing technology.
Project description:In this study, we sequenced small RNA content from three different rice cultivars employing Illumina technology. More than 15 million reads were generated using Illumina high-throughput sequencing platform. After pre-processing, distinct small RNA sequences were identified for each rice cultivars.
Project description:We report the application of Illumina Hiseq2000 sequencing technology for high-throughput miRNA profiling of the rheumatoid arthritis (RA) rat model induced by collagen type II (CIA), with acupuncture and placebo treatments.
2016-12-23 | GSE58459 | GEO
Project description:Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms (MiSeq)
