Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Citrus cavaleriei

ABSTRACT: Characterization of Ichang papedas (Citrus ichangensis) grown in China and its relatives grown in Bhutan using high-throughput sequencing

PROVIDER: PRJDB3070 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	DRR022948.fastq.gz	Fastqsanger.gz
	DRR022949.fastq.gz	Fastqsanger.gz
	DRR022950.fastq.gz	Fastqsanger.gz
	DRR022951.fastq.gz	Fastqsanger.gz

Items per page:

1 - 4 of 4

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Identification and Characterization of Key Genes Responsible for Weedy and Cultivar Growth Types in Soybean

Project description:We report total mRNA library using Illumina Nova Seq high-throughput sequencing platform platform for analysis of transcriptome between the two relatives of the soybean ie weedy and cultivar growth types in F7 generation derived from the crossing of wild and cultivated soybean.

2021-11-12 | GSE188519 | GEO

Illumina miRNA sequencing revealed Citrus adaptation to long-term B-toxicity through modulation of lateral root development by miR319

Project description:We report the application of Illumina sequencing for high-throughput profiling of miRNA in citrus root responded to long-term boron toxicity. We find miR319 is involved in citrus adapation to long-term boron toxicity via targeting a MYB gene, Ciclev10000756m.g.v1.0, which is homologus with several MYBs that modulate lateral root development in Arabidopsis.

2021-02-25 | GSE111128 | GEO

To explore the relationship between new gene expression / mutation and survival of patients in colorectal cancer

Project description:Interventions: Case vs control:No Primary outcome(s): High-throughput sequencing Study Design: Case-Control study

| 2676067 | ecrin-mdr-crc

New xylose transporters support the simultaneous consumption of glucose and xylose in Escherichia coli

Project description:RNA-seq libraries were constructed for six samples, including AE1.0, AE2.0, PS1.0, PS2.0, REV1.0, REV2.0 . For preparation of RNA samples, Co-utilization were assessed using AM1 mineral salt media supplemented with glucose and xylose at each concentration of 50 g·L-1. Seed culture were grown overnight (16 h) in AM1 medium supplemented with 2% sugar. For each experiment, E. coli was grown at 37 ℃ in a pH-controlled fermentation vessel with the initial cell density at OD550nm of 0.1.Total RNA for samples were isolated using TRIzol reagent (Invitrogen, Grand Island, USA), then used for high-throughput RNA sequencing. The 150-nt paired-end RNA-seq libraries were generated commercially at Novogene Biotechnology Co. Ltd (Tianjin, China) by using Illumina’s Hiseq X Ten platform (Illumina, San Diego, USA).

2022-10-01 | GSE186804 | GEO

Uncover miRNAs in citrus fruit ripening

Project description:Fruit ripening in Citrus is not well understood at the molecular level. Knowledge of the regulatory mechanism of citrus fruit ripening at the post-transcriptional level in particular is lacking. Here, we comparatively analyzed the miRNAs and their targeted genes in a spontaneous late-ripening mutant, ?Fengwan? sweet orange (MT) (Citrus sinensis L. Osbeck), and its wild-type counterpart ('Fengjie 72-1', WT). Using high-throughput sequencing of small RNAs and RNA degradome tags, we identified 107 known and 21 novel miRNAs, as well as 225 target genes. A total of 24 miRNAs (16 known miRNAs and 8 novel miRNAs) were shown to be differentially expressed between MT and WT. The expression pattern of several key miRNAs and their target genes during citrus fruit development and ripening stages was examined. Csi-miR156k, csi-miR159 and csi-miR166d suppressed specific transcription factors (GAMYBs, SPLs and ATHBs) that are supposed to be important regulators involved in citrus fruit development and ripening. In the present study, miRNA-mediated silencing of target genes was found under complicated and sensitive regulation in citrus fruit. The identification of miRNAs and their target genes provide new clues for future investigation of mechanisms that regulate citrus fruit ripening.

2017-02-10 | GSE84191 | GEO

Characterization of a large dataset of SNPs in Larimichthys polyactis using high throughput 2b-RAD sequencing

Project description:Single nucleotide polymorphism (SNP) characterization and genotyping of Larimichthys polyactis by using high-throughput 2b-RAD sequencing technology

2020-02-26 | PRJEB36912 | EVA

Project description:Diet characterization of the Mexican harbor seal using high-throughput DNA sequencing

| PRJNA518147 | ENA

Project description:RAD-Seq of Citrus relatives

| PRJDB5923 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data