Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.
Project description:Expanding healthy life expectancy requires technologies for continuous and non-invasive health monitoring. Sensors detecting health-related biomarkers in urine can be used for such applications. DNA aptamers targeting equol, a gut microbiota–derived metabolite with various health benefits, were obtained by Capture-SELEX to construct the aptamer-based equol sensors.
Project description:Blocking the PD-1/PD-L1 immunosuppressive pathway has shown promise in the treatment of certain cancers including melanoma. This study investigates differences in the gene expression profiles of human melanomas that do or do not display the immunosuppressive protein PD-L1. Further understanding of genes expressed within the tumor microenvironment of PD-L1+ tumors may lead to improved rationally designed treatments. Gene expression profiling was performed on total RNA extracted by laser capture microdissection from 11 archived formalin-fixed paraffin-embedded (FFPE) melanoma specimens, 5 of which were PD-L1 positive and 6 PD-L1 negative. Details of the design, and the gene signatures found are given in the paper associated with this GEO Series: Janis M. Taube, Geoffrey D. Young, Tracee L. McMiller, Shuming Chen, January T. Salas, Theresa S. Pritchard, Haiying Xu, Alan K. Meeker, Jinshui Fan, Chris Cheadle, Alan E. Berger, Drew M. Pardoll, and Suzanne L. Topalian, Differential expression of immune-regulatory genes associated with PD-L1 display in melanoma: implications for PD-1 pathway blockade, Clin Cancer Res 2015, in press.
Project description:To identify which E3 ligases ubiquitinate PD-L1, we overexpressed PD-L1-Flag in HEK293 cells and used anti-Flag magnetic beads to pull down PD-L1 from cell lysates. The interacting proteins were then analyzed by mass spectrometry, revealing that three E3 ligases interact with PD-L1.