Nonpathogenic E. coli displaying decoy-resistant IL18 mutein enhance the efficacy of cancer immunotherapies
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1150592 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR30331620_1.fastq.gz | Fastqsanger.gz | |||
| SRR30331620_2.fastq.gz | Fastqsanger.gz | |||
| SRR30331621_1.fastq.gz | Fastqsanger.gz | |||
| SRR30331621_2.fastq.gz | Fastqsanger.gz | |||
| SRR30331622_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 32 |
Similar Datasets
Project description:The tumor microenvironment can inhibit the efficacy of cancer therapies through mechanisms such as poor trafficking and exhaustion of immune cells. To address this challenge, we exploited the safety, tumor tropism, and ease of genetic manipulation of non-pathogenic Escherichia coli (E. coli) to deliver key immune-activating cytokines to tumors via surface display on the outer membrane of E. coli K-12 DH5a. Non-pathogenic E.coli expressing murine decoy-resistant IL18 mutein (DR18) induced robust CD8+ T and NK cell-dependent immune responses and suppressed tumor progression in immune-competent colorectal carcinoma and melanoma mouse models. E. coli K-12 DH5a engineered to display human DR18 potently activated mesothelin-targeting CAR NK cells and enhance their trafficking into tumors, which extended survival in an NK cell treatment-resistant mesothelioma xenograft model by enhancing TNFa signaling and upregulating NK activation markers. Our live bacteria-based immunotherapeutic system safely and effectively induces potent anti-tumor responses in treatment-resistant solid tumors, motivating further evaluation of this approach in the clinic.
2024-08-22 | GSE275391 | GEO
Project description: Not available
| S-EPMC12797303 | biostudies-literature
Project description:Interleukin-18 (IL-18) was one of the inflammatory cytokines and related to major depressive disorder (MDD) and dementia. We previously investigated IL-18 knockout (Il18−/−) mice developed impaired learning and memory, more anxiety, and less motivation comparing to Il18+/+ mice. In the Il18−/− mice with acute stress, both the immobility time in the forced swim test and the tail suspension test were decreased, even though no difference was observed in the Il18+/+ mice. To reveal the mechanism, RNA-Seq was performed.
2022-10-21 | GSE207669 | GEO
Project description:Species differ markedly in how they regulate immune responses, yet the molecular basis of this variation remains incompletely understood. Here, we show that an ancient LINE2 retrotransposon introduced an intronic polyadenylation signal into the IL18R1 locus, generating a truncated isoform, IL18R1-Short, that lacks the intracellular signaling domain. Using bulk RNA-seq across nine mammals, we find that although this cis-regulatory element is broadly conserved, robust IL18R1-Short expression is species- and tissue-restricted: bats and mice express it at high levels, particularly in barrier tissues (lung, skin, intestine), whereas most other species, including humans, show absent or limited expression. Single-cell lung profiling further shows that this truncated isoform is enriched in mouse epithelial cells. Known IL18 negative regulators, SIGIRR and IL18BP, also show distinct expression patterns across mouse and human lung cell populations, suggesting that these brakes on IL18 signaling are deployed in context-dependent and non-redundant manner. Functionally, IL18R1-Short dampens IL18-induced NFkB signaling in both human and mouse systems, and knockdown of the mouse ortholog amplifies IL18-driven immune and inflammatory gene expression in mouse T cells. Together, these results identify IL18R1-Short as a TE-derived decoy receptor that attenuates IL18 signaling and show that conservation of a TE-derived cis element does not predict conserved regulatory output. More broadly, these findings establish IL18R1-Short as an example of how TEs can generate alternative immune transcripts with species-specific regulatory consequences, highlighting TE-mediated alternative transcription as an underappreciated source of mammalian immune variation.
2026-05-09 | GSE324646 | GEO
Project description:Species differ markedly in how they regulate immune responses, yet the molecular basis of this variation remains incompletely understood. Here, we show that an ancient LINE2 retrotransposon introduced an intronic polyadenylation signal into the IL18R1 locus, generating a truncated isoform, IL18R1-Short, that lacks the intracellular signaling domain. Using bulk RNA-seq across nine mammals, we find that although this cis-regulatory element is broadly conserved, robust IL18R1-Short expression is species- and tissue-restricted: bats and mice express it at high levels, particularly in barrier tissues (lung, skin, intestine), whereas most other species, including humans, show absent or limited expression. Single-cell lung profiling further shows that this truncated isoform is enriched in mouse epithelial cells. Known IL18 negative regulators, SIGIRR and IL18BP, also show distinct expression patterns across mouse and human lung cell populations, suggesting that these brakes on IL18 signaling are deployed in context-dependent and non-redundant manner. Functionally, IL18R1-Short dampens IL18-induced NFkB signaling in both human and mouse systems, and knockdown of the mouse ortholog amplifies IL18-driven immune and inflammatory gene expression in mouse T cells. Together, these results identify IL18R1-Short as a TE-derived decoy receptor that attenuates IL18 signaling and show that conservation of a TE-derived cis element does not predict conserved regulatory output. More broadly, these findings establish IL18R1-Short as an example of how TEs can generate alternative immune transcripts with species-specific regulatory consequences, highlighting TE-mediated alternative transcription as an underappreciated source of mammalian immune variation.
2026-05-09 | GSE324648 | GEO
Project description:Species differ markedly in how they regulate immune responses, yet the molecular basis of this variation remains incompletely understood. Here, we show that an ancient LINE2 retrotransposon introduced an intronic polyadenylation signal into the IL18R1 locus, generating a truncated isoform, IL18R1-Short, that lacks the intracellular signaling domain. Using bulk RNA-seq across nine mammals, we find that although this cis-regulatory element is broadly conserved, robust IL18R1-Short expression is species- and tissue-restricted: bats and mice express it at high levels, particularly in barrier tissues (lung, skin, intestine), whereas most other species, including humans, show absent or limited expression. Single-cell lung profiling further shows that this truncated isoform is enriched in mouse epithelial cells. Known IL18 negative regulators, SIGIRR and IL18BP, also show distinct expression patterns across mouse and human lung cell populations, suggesting that these brakes on IL18 signaling are deployed in context-dependent and non-redundant manner. Functionally, IL18R1-Short dampens IL18-induced NFkB signaling in both human and mouse systems, and knockdown of the mouse ortholog amplifies IL18-driven immune and inflammatory gene expression in mouse T cells. Together, these results identify IL18R1-Short as a TE-derived decoy receptor that attenuates IL18 signaling and show that conservation of a TE-derived cis element does not predict conserved regulatory output. More broadly, these findings establish IL18R1-Short as an example of how TEs can generate alternative immune transcripts with species-specific regulatory consequences, highlighting TE-mediated alternative transcription as an underappreciated source of mammalian immune variation.
2026-05-09 | GSE324647 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Interleukin-18 (IL-18) was one of the inflammatory cytokines and related to major depressive disorder (MDD) and dementia. Compared with Il18+/+ mice, IL-18 knockout (Il18−/−) mice developed impaired learning and memory, more anxiety, and less motivation. To reveal the mechanism, the microarray was performed.
2019-12-31 | GSE108485 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- with restraint stress
| PRJNA856658 | ENA