Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rDNA sequencing of mouse feces

PROVIDER: PRJNA1221353 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR32281000_1.fastq.gz	Fastqsanger.gz
	SRR32281000_2.fastq.gz	Fastqsanger.gz
	SRR32281001_1.fastq.gz	Fastqsanger.gz
	SRR32281001_2.fastq.gz	Fastqsanger.gz
	SRR32281002_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 36

Similar Datasets

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

Regulatory Effects of Berberine on Intestinal Microecology in Mice with Ulcerative Colitis

Project description:16S rDNA sequencing data from mouse feces

| PRJEB101457 | ENA

Fecal microbiota in mice before and after repeated mild stress

Project description:To examine potential changes of the intestinal microbiota in mice caused by repeated mild stress, we profiled bacteria and fungi in the mouse feces by sequencing the 16s v3v4 region and the ITS1-2 region.

2024-09-23 | GSE222533 | GEO

Effect of trans-vaccenic acid(TVA) diet on 16S ribosomal RNA (rRNA) expression of mouse gut microbiome

Project description:To investigate the TVA diet's effect on mouse gut microbiome, we fed C57/BL6 mice with TVA diet or CON diet for 18 days We then collected feces of the mice and performed 16S ribosomal RNA (rRNA) sequencing.

2023-09-21 | GSE202266 | GEO

Mouse caecum vs faeces - Metaproteogenomics Reveals Taxonomic and Functional Changes between Cecal and Fecal Microbiota in Mouse

Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.

2017-03-31 | PXD004911 | Pride

Correlation analysis between gut microbiota characteristics and melasma

Project description:To compare the similarities and differences in species diversity of the gut microbiota between the patients with melasma and healthy subjects. The feces were collected for 16S rRNA sequencing analysis of the gut microbiota.

2022-10-25 | GSE214430 | GEO

Gut microbiota drives vitiligo-related oxidative stress in skin via the metabolite Hippuric Acid

Project description:Vitiligo is a common autoimmune skin disorder. We constructed an induced vitiligo mouse model and performed bulk-RNA sequencing on the skin and 16S rRNA sequencing of feces from vitiligo mice and uninduced mice. Next, we performed skin bulk-RNA sequencing after treatment using ABX. Lastly, we subjected gut microbe-related metabolite hippuric acid to control mice and performed bulk-RNA sequencing on the skin to observe oxidative stress-related gene expression changes.

2024-08-21 | GSE273242 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

16S rRNA gene sequence analysis of feces samples from rats treated with paclitaxel or vehicle controls

Project description:To address the role of gut microbiota in the development of paclitaxel-induced peripheral neuropathy (PIPN), we performed 16S rRNA sequencing analysis of feces samples at 14 days and 28 days after the initiation of paclitaxel or vehicle injections.

2023-10-16 | E-MTAB-13426 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data