Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Amplicon-seq target 16S, ITS, and Protist in Guangxi, China

PROVIDER: PRJNA1248460 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR33046800.fastq.gz	Fastqsanger.gz
	SRR33046900.fastq.gz	Fastqsanger.gz
	SRR33047000.fastq.gz	Fastqsanger.gz
	SRR33046801.fastq.gz	Fastqsanger.gz
	SRR33046901.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 306

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:South China Sea Cold Seep 16S & ITS Target Amplicon Sequencing

| PRJNA836361 | ENA

Project description:MTB in Guangxi, China

| PRJNA976255 | ENA

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Microbial communities in the gut of the beetle Odontotaenius disjunctus

Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections

2012-08-14 | GSE40067 | GEO

Gut microbiota analysis of kdm5 mutant and the flies with KDM5 knockdown in intestine tissue

Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.

2019-02-08 | GSE98944 | GEO

Project description:Amplicon sequencing of 16S, ITS and protist in soil

| PRJNA1044395 | ENA

Project description:South China Sea interfaces 16S amplicon sequencing

| PRJNA362622 | ENA

d5d72445-ec4a-4414-8c06-9e9324628c62 - samples

Project description:Off-target amplification can lead to false positive human brain microbiome detection. 16s rRNA amplicon samples from brain tissue of healthy and Parkinson's disease patients.

| EGAD00001006553 | EGA

Expression data from the longuissimus dorsi muscle of Qinchuan cattle, Qinghai yak and Guangxi buffalo at 36 months

Project description:Sex condition has been demonstrated to alter meat quality and sex is a major factor that affects the fatty acid composition of lipids of carcass dissectible or intramuscular depot fats. But the possible genetic molecular mechanism of gender causing meat quality differences is not well defined. Qinchuan cattle, Qinghai yak and Guangxi buffalo are three typical indigenous species of cattle in China. Obivious differences of meat quality exist among the three species of cattle. Few studies have been conducted to elucidate the muscle tissue expression of genes involved in pathways and mechanisms leading to meat quality differences beyond the phenotype properties of beef. Bovine Genome Arrays were used to construct muscle expression profiles of the longuissimus dorsi from Qinchuan cattle at 36 months and screen differentially expressed genes in the longuissimus dorsi muscle tissues among different genders of Qinchuan cattle, between Qinchuan cattle and Qinghai yak, and between Qinchuan cattle and Guangxi buffalo.

2009-12-23 | GSE19586 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data