Project description:We conducted 16S rRNA sequencing analyse on colonic contents to evaluate whether forced loss led to alterations in gut microbiota composition and function.
Project description:Interventions: Case (colorectal cancer) group:a newly diagnosed colorectal cancer( CRC ) by colonoscopy and pathology;Control group:Clinically healthy volunteers with no symptoms or history of intestinal disease(e.g. colonic adenomatous polyps, CRC or inflammatory bowel disease)
Primary outcome(s): composition of gut microbiota;intestinal microbial phytase activity;16s rRNA metagenomic sequencing;diet surveys;phytic acid intake
Study Design: Case-Control study
Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.
2017-03-31 | PXD004911 | Pride
Project description:16s sequencing of mouse colonic contents
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
