Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rDNA sequence data of human feces

PROVIDER: PRJNA1265424 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR33637300_1.fastq.gz	Fastqsanger.gz
	SRR33637300_2.fastq.gz	Fastqsanger.gz
	SRR33637600_1.fastq.gz	Fastqsanger.gz
	SRR33637600_2.fastq.gz	Fastqsanger.gz
	SRR33637301_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 352

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

human gut metagenome

Project description:Human feces metagenome 16s rDNA sequencing

| PRJNA307231 | ENA

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

Project description:Diabetes (human) feces 16s rDNA sequencing-DN

| PRJNA860744 | ENA

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

Generation of Hematopoietic TF-rDNA Atlas in Human and Mouse

Project description:Over 2000 publicly accessible human and mouse ChIP-Seq datasets for about 250 Transcription Factors and chromatin complexes from various databases (ENCODE, GEO) were mapped to custom-made human and mouse genomes containing a reference rDNA sequence of the appropriate species (Genbank U13369.1 for human, BK000964.3 for mouse). The read mapping density across the rDNA sequence was then extracted and normalized to the median in that dataset. Unbiased clustering and analysis, followed by curation, was performed to identify high-confidence patterns of rDNA occupancy for numerous hematopoietic TFs and TF families at canonical TF motif sequences. ************************ Data processing steps: FASTQs were trimmed using Trimmomatic with the following parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:30 Reads were mapped to customized genomes (containing additional rDNA sequence) using Bowtie2 using the following parameter: -X 2000 Read density across the rDNA sequence was extracted using igvtools ************************

2022-01-15 | GSE191272 | GEO

Feces 16S rRNA seq of mice treated by AZ1 with 2.5% DSS or H2O

Project description:Feces 16s rRNA seq experiments is required to demonstrate the AZ1 doesn’t impact the intestinal microbiota.

2020-02-14 | GSE143003 | GEO

Project description:16S rDNA sequence raw data

| PRJNA915316 | ENA

Mus musculus feces 16s rDNA sequencing

Project description:Mus musculus feces 16s rDNA sequencing Raw sequence reads

| PRJNA874477 | ENA

Project description:16S rDNA of microbiota in feces. Raw sequence reads

| PRJNA550022 | ENA