Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18~20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:16S rDNA sequence data of human feces
| PRJNA1265424 | ENA
Project description:16S rDNA sequence data of human feces
| PRJNA1423455 | ENA
Project description:Feces of diabetes rats in 16s rDNA sequencing-NC and MC group
Project description:To compare the similarities and differences in species diversity of the gut microbiota between the patients with melasma and healthy subjects. The feces were collected for 16S rRNA sequencing analysis of the gut microbiota.