Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Homo sapiens

ABSTRACT: An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-κB as an example

PROVIDER: PRJNA210965 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR928995.fastq.gz	Fastqsanger.gz
	SRR928996.fastq.gz	Fastqsanger.gz
	SRR928998.fastq.gz	Fastqsanger.gz
	SRR928999.fastq.gz	Fastqsanger.gz
	SRR949192.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 5

Similar Datasets

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-κB as an example

2014-05-05 | GSE48660 | GEO

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

Global interactome mapping reveals pro-cancerous interactions of NF-κB in breast cancer

Project description:NF-κB has an essential role in innate immune response and inflammation and is involved in cancer development and progression. We apply the SEC-PCP-SILAC method incorporating metabolic labeling, size exclusion chromatography and protein correlation profiling to construct a complex network of interactome rearrangement in response to NF-κB modulation in breast cancer cells. Our interaction network represents a complex insight into the dynamics of MCF-7 protein interactome associated with NF-κB pathway. Our dataset could serve as a basis for future studies characterizing role of NF-κB in breast cancer cellular pathways. This PRIDE project includes results from SILAC labeled and label-free replicates from the SEC-PCP-SILAC analysis of protein complexes in MCF-7 cells with inhibited and uninhibited NF-κB pathway, results from the immunoprecipitation experiment aimed at interaction partners of NF-κB factor RELA, analysis of total proteome after NF-κB inhibition, and results from SEC fractionation of untreated and unlabeled MCF-7 cells.

2024-02-28 | PXD040125 | Pride

Quantitative modeling of transcription factor binding specificities using DNA shape

2015-03-01 | GSE60200 | GEO

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

TLR4-NFkB-phospho-NF-kB signaling in BMDM

Project description:The model was constructed to describe TLR4 induced NF-κB activation in native bone marrow-derived macrophages. It included processes of ligand (lipopolysaccharide) recognition, formation of dimer receptor complex and further signal transduction through TRAF6/TAK1 complex that leads to the activation of IKKα/β kinase, which in turn enables the NF-κB transcription factor phosphorylation and translocation in the cell nucleus, and induction of IkB and WIP1 (as an example of induced protein that promotes NF-κB dephosphorylation 2) gene transcription. Models were based on the current knowledge of TLR signaling framework, protein interactions within the TLR4 pathway, and up-to-date mathematical models describing Toll receptor activation. The major important additions were made to TLR4 signaling description: 1) Receptor dimerization process 2) The existence of a basal nuclear NF-κB level (translocation) 3) NF-κB phosphorylation by IKK complex

2019-03-27 | MODEL1809230001 | BioModels

A Novel, Dynamic Pattern-based Analysis of NF-kappaB Binding During the Priming Phase of Liver Regeneration Reveals Switch-Like Functional Regulation

Project description:Following partial hepatectomy, a coordinated series of molecular events occurs to regulate hepatocyte entry into the cell cycle to recover lost mass. In rats during the first six hours following resection, hepatocytes are primed by a tightly controlled cytokine response to prepare hepatocytes to begin replication. Although it appears to be a critical element driving regeneration, the cytokine response to resection has not yet been fully characterized. Specifically, the role of one of the key response elements to cytokine signaling (NF-κB) remains incompletely characterized. In this study, we present a novel, genome-wide, pattern-based analysis characterizing NF-κB binding during the priming phase of liver regeneration. We interrogated the dynamic regulation of priming by NF-κB through categorizing NF-κB binding in different temporal profiles: immediate sustained response, early transient response, and delayed response to partial hepatectomy. We then identified functional regulation of NF-κB binding by relating the temporal response profile to differential gene expression. We found that NF-κB bound genes govern negative regulation of cell growth and inflammatory response immediately following hepatectomy. NF-κB also transiently regulates genes responsible for lipid biosynthesis and transport as well as induction of apoptosis following hepatectomy. By the end of the priming phase, NF-κB regulation of genes involved in inflammatory response, negative regulation of cell death, and extracellular structure organization became prominent. These results suggest that the immediate, transient, and delayed NF-κB signaling serve different functional transitions that drive the onset of regeneration.

2015-07-07 | GSE70522 | GEO

Multi-species RELA ChIP-seq of mammalian aortic endothelial cells before and after TNFα stimulation

Project description:TNFα has an evolutionary conserved role in mediating inflammation via activation of the transcription factor NF-κB. The functions of individual NF-κB binding sites are not well understood. To identify conserved and functionally important NF-κB binding sites in mammals, we performed ChIP-seq to map the genome-wide binding of RELA and select histone modifications in primary vascular endothelial cells (ECs) isolated from the aortas of human (HAEC), mouse (MAEC) and cow (BAEC), before and after TNFα. The conserved RELA binding sites show strong epigenetic changes in response to TNFα and enrich near genes controlling vascular development and pro-inflammatory responses. Our method identifies novel modes of RELA-chromatin interactions that are conserved in mammals and shared between multiple cell-types. Particularly, genomic regions bound by RELA prior to stimulation are important responders during TNFα stimulation. We use CRISPR/Cas9 genome editing to validate the roles of the conserved RELA pre-bound sites near pro-inflammatory genes such as CCL2 and PLK2. Our evolutionary approach describes new aspects of mammalian NF-κB biology including its role within super-enhancers and relevance in inflammatory disorders.

2020-10-03 | E-MTAB-7889 | biostudies-arrayexpress

HT-SELEX of wild-type and mutated versions of recombinant DNA binding domain of SALL4

Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.

2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress

Interactome profiling of a lysine deacetylase trapping probe library uncovers crosstalk between HDAC6 and NF-κB signaling

Project description:Lysine or histone deacetylases (HDACs) remove acetyl groups from lysine residues of numerous proteins, thereby regulating their function, activity and localization. Putative HDAC6 substrate sites, uncovered in the acetylome of HDAC6 knockdown cells, served as basis for the design of an HDAC6-trapping peptide library containing hydroxamic acids. Most probes enriched HDAC6 stronger from cell lysates than HDAC1. Probe sequences derived from α-tubulin, CRTC3, HSP90 and PPIA were confirmed as HDAC6 substrates and proteomics profiling of the corresponding trapping probes revealed preferential enrichment of HDAC6 together with known and previously unknown binding proteins. These included proteins of the NF-κB signaling complex which were independently confirmed as HDAC6 binders. NF-κB protein p50 was deacetylated by HDAC6 counteracting enhanced transcription of NF-κB target genes induced by p50 acetylation. These findings indicate a potential anti-inflammatory function of HDAC6 in NF-κB signaling.

2025-07-02 | PXD044143 | JPOST Repository

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data