Landscape of ribosome-engaged alternative transcript isoforms across neuronal cell classes
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA552065 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR9623780_1.fastq.gz | Fastqsanger.gz | |||
| SRR9623780_2.fastq.gz | Fastqsanger.gz | |||
| SRR9623790_1.fastq.gz | Fastqsanger.gz | |||
| SRR9623790_2.fastq.gz | Fastqsanger.gz | |||
| SRR9623800_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 64 |
Similar Datasets
Project description:The goal of this project was to assess how alternative splicing programs are arrayed across neuronal cells types. We systematically mapped ribosome-associated transcript isoforms in genetically-defined neuron types of the mouse forebrain. The endogenous ribosomal protein Rpl22 was conditionally HA-tagged in glutamatergic neurons (using CamK2-cre for most neocortical pyramidal cells and Scnn1a-cre for spiny stellate and star pyramid layer 4 cells), and GABAergic interneurons [with somatostatin-cre (SST), parvalbumin-cre (PV) and vasointestinal peptide-cre (VIP)]. Within the hippocampus, we further targeted Cornu ammonis 1 (CA1) neurons (CamK2-cre), CA3 neurons (Grik4-cre), and SST-positive interneurons (SST-cre). Four replicates were deep sequenced (~100 million reads) using an Illumina platform. We find that neuronal transcript isoform profiles reliably distinguish even closely-related classes of pyramidal cells and inhibitory interneurons in the mouse hippocampus and neocortex, positing transcript diversification by alternative splicing as a central mechanism for the functional specification of neuronal cell types and circuits.
2019-07-01 | GSE133291 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:Nervous system function relies on complex assemblies of distinct neuronal cell types that have unique anatomical and functional properties instructed by molecular programs. Alternative splicing is a key mechanism for the expansion of molecular repertoires, and protein splice isoforms shape neuronal cell surface recognition and function. However, the logic of how alternative splicing programs are arrayed across neuronal cells types is poorly understood. We systematically mapped ribosome-associated transcript isoforms in genetically defined neuron types of the mouse forebrain. Our dataset provides an extensive resource of transcript diversity across major neuron classes. We find that neuronal transcript isoform profiles reliably distinguish even closely related classes of pyramidal cells and inhibitory interneurons in the mouse hippocampus and neocortex. These highly specific alternative splicing programs selectively control synaptic proteins and intrinsic neuronal properties. Thus, transcript diversification via alternative splicing is a central mechanism for the functional specification of neuronal cell types and circuits.
| S-EPMC6763336 | biostudies-literature
Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.
2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress
Project description:Genome-wide measurements of ribosome occupancy on mRNA transcripts have enabled global empirical identification of translated regions. These approaches have revealed an unexpected diversity of protein products, but high-confidence identification of new coding regions that entirely overlap annotated coding regions – including those that encode truncated protein isoforms – has remained challenging. Here, we develop a sensitive and robust algorithm focused on identifying N-terminally truncated proteins genome-wide, identifying 388 truncated protein isoforms, a more than 30-fold increase in the number known in budding yeast. We perform extensive experimental validation of these truncated proteins and define two general classes. The first set lack large portions of the annotated protein sequence and tend to be produced from a truncated transcript. We show two such cases, Yap5truncation and Pus1truncation, to have condition-specific regulation and functions that appear distinct from their respective annotated isoforms. The second set of N-terminally truncated proteins lack only a small region of the annotated protein and are less likely to be regulated by an alternative transcript isoform. Many localize to different subcellular compartments than their annotated counterpart, representing a common strategy for achieving dual localization of otherwise functionally identical proteins.
2024-04-16 | GSE235852 | GEO
Project description:Quantification of transcript isoforms at the single-cell level using SCALPEL
| PRJNA1115197 | ENA
Project description:Long-read RNA sequencing (RNA-seq) holds great potential for characterizing transcriptome variation and full-length transcript isoforms, but the relatively high error rate of current long-read sequencing platforms poses a major challenge. We present ESPRESSO, a computational tool for robust discovery and quantification of transcript isoforms from error-prone long reads. ESPRESSO jointly considers alignments of all long reads aligned to a gene and uses error profiles of individual reads to improve the identification of splice junctions and the discovery of their corresponding transcript isoforms. On both a synthetic spike-in RNA sample and human RNA samples, ESPRESSO outperforms multiple contemporary tools in not only transcript isoform discovery but also transcript isoform quantification. In total, we generated and analyzed ~1.1 billion nanopore RNA-seq reads covering 30 human tissue samples and three human cell lines. ESPRESSO and its companion dataset provide a useful resource for studying the RNA repertoire of eukaryotic transcriptomes.
2022-10-14 | GSE192955 | GEO
Project description:Direct RNA sequencing enables single-nucleotide m6A detection in endogenous transcript isoforms
| PRJNA549597 | ENA
Project description:Cellular stress responses often require transcription-based activation of gene expression to promote cellular adaptation. Whether general mechanisms exist for stress-responsive gene down-regulation is less clear. A recently defined mechanism enables both up- and down-regulation of protein levels for distinct gene sets by the same transcription factor (TF) via coordinated induction of canonical mRNAs and long undecoded transcript isoforms (LUTIs). We analyzed parallel gene expression datasets to determine whether this mechanism contributes to the conserved Hac1-driven branch of the unfolded protein response (UPRER), indeed observing Hac1-dependent protein down-regulation accompanying the up-regulation of ER-related proteins that typifies UPRER activation. Proteins down-regulated by Hac1-driven LUTIs include those with electron transport chain (ETC) function. Abrogated ETC function improves the fitness of UPRER-activated cells, suggesting functional importance to this regulation. We conclude that the UPRER drives large-scale proteome remodeling, including coordinated up- and down-regulation of distinct protein classes, which is partly mediated by Hac1-induced LUTIs.
2018-06-12 | MSV000082454 | MassIVE