Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Direct RNA sequencing enables single-nucleotide m6A detection in endogenous transcript isoforms

ABSTRACT: Direct RNA sequencing enables single-nucleotide m6A detection in endogenous transcript isoforms

PROVIDER: PRJNA549597 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR9646141_1.fastq.gz	Fastqsanger.gz
	SRR9646142_1.fastq.gz	Fastqsanger.gz
	SRR9646143_1.fastq.gz	Fastqsanger.gz
	SRR9646144_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 4 of 4

Similar Datasets

Direct RNA sequencing enables single-nucleotide m6A detection in endogenous transcript isoforms

Project description:We report the direct RNA sequencing of HEK293 and a primary human mammary epithelial cell (HMEC) line using Oxford Nanopore based sequencing. Using this data, we built an algorithm to detect m6A modifications within the DRACH motif context. Evaluation of m6A sites was carried out with HEK METTL3 knockdown and HMEC ALKBH5 over expression cell lines.

2020-01-14 | GSE132971 | GEO

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.

2016-01-11 | GSE69352 | GEO

Direct RNA sequencing enables m<sup>6</sup>A detection in endogenous transcript isoforms at base-specific resolution.

Project description: Not available

| S-EPMC6913132 | biostudies-literature

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Single-molecule, full-length transcript isoform sequencing reveals disease-associated RNA isoforms

Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.

2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress

2'-O-methylation of the second transcribed nucleotide in eukaryotic RNA 5’ cap impacts protein production levels and susceptibility to DXO-mediated transcript degradation

Project description:Eukaryotic mRNA 5’ end is decorated with cap structure which plays multiple roles in the cell. Most importantly, protects transcript from exonucleolytic degradation and enables translation of encoded protein conducted by cap-dependent machinery. This is also a key feature in the process of recognizing RNA as self or non-self molecule by cellular innate immune system. Cap is composed of 7-methylguanosine linked by a 5′,5′-triphosphate chain to the first transcribed nucleotide, and is formed enzymatically during transcription. This m7GpppN structure, called cap0, can be further modified by CMTR1 methyltransferase to cap1 (m7GpppNm), which predominates in eukaryotic cells. Cap2, with additional 2′-O-methylation at the second transcribed nucleotide (m7GpppNmpNm) added by another methyltransferase CMTR2, also can be found at mRNA 5’ end. We present new tools allowing for in vitro synthesis of RNAs possessing cap2, i.e tetranucleotide cap analogues. Utilizing these for in vitro transcription reactions we obtained RNAs with 2′-O-methylation present at the second transcribed nucleotide. Due to that we investigated the role of cap2 in protein production from reporter mRNA protected with this structure in different conditions, normal or stress ones, or with CMTR1/2 down regulated level. We also assessed the affinity of eIF4E protein to differentially capped RNAs. Furthermore, we verified whether an additional 2′-O-methylation presence in capped RNA makes transcript more resistant to decapping enzyme action.

2022-09-08 | PXD028636 | Pride

Landscape of ribosome-engaged alternative transcript isoforms across neuronal cell classes

Project description:Landscape of ribosome-engaged alternative transcript isoforms across neuronal cell classes

| PRJNA552065 | ENA

Quantification of transcript isoforms at the single-cell level using SCALPEL

Project description:Quantification of transcript isoforms at the single-cell level using SCALPEL

| PRJNA1115197 | ENA

ESPRESSO: Robust discovery and quantification of transcript isoforms from error-prone long-read RNA-seq data

Project description:Long-read RNA sequencing (RNA-seq) holds great potential for characterizing transcriptome variation and full-length transcript isoforms, but the relatively high error rate of current long-read sequencing platforms poses a major challenge. We present ESPRESSO, a computational tool for robust discovery and quantification of transcript isoforms from error-prone long reads. ESPRESSO jointly considers alignments of all long reads aligned to a gene and uses error profiles of individual reads to improve the identification of splice junctions and the discovery of their corresponding transcript isoforms. On both a synthetic spike-in RNA sample and human RNA samples, ESPRESSO outperforms multiple contemporary tools in not only transcript isoform discovery but also transcript isoform quantification. In total, we generated and analyzed ~1.1 billion nanopore RNA-seq reads covering 30 human tissue samples and three human cell lines. ESPRESSO and its companion dataset provide a useful resource for studying the RNA repertoire of eukaryotic transcriptomes.

2022-10-14 | GSE192955 | GEO

Part 2 JAWS; 2'-O-methylation of the second transcribed nucleotide in eukaryotic RNA 5’ cap impacts protein production levels and susceptibility to DXO-mediated transcript degradation

2022-09-08 | PXD028635 | Pride