Sort   by:  
 Page size 
TranscriptomicsHuman hepatocellular carcinomas validation set
A disease state experiment design type is where the state of some disease such as infection, pathology, syndrome, etc is studied. Keywords: disease_state_design Computed
ORGANISM(S): Homo sapiens 
2007-08-09 | E-GEOD-8652 | biostudies-arrayexpress
TranscriptomicsSirt6 study
This SuperSeries is composed of the following subset Series: GSE13206: Human shSIRT6 TNF-alpha timecourse GSE13207: Mouse Sirt6-/- TNF-alpha timecourse GSE13208: Mouse Sirt6-/- tissues GSE13209: Mouse Sirt6-/- RelA+/- tissues Refer to individual Series
ORGANISM(S): Mus musculus 
2010-06-24 | E-GEOD-13272 | biostudies-arrayexpress
TranscriptomicsHuman shSIRT6 TNF-alpha timecourse
We established HeLa cell lines stably expressing a short hairpin RNA against SIRT6 (S6 sh2), and then completed genome-wide microarray analysis in shSIRT6 knock-down and control pSR HeLa cells. Prior to RNA extraction, HeLa cells were treated with TNF-alpha (5 ng/ml) for the indicated times. Total R...
ORGANISM(S): Homo sapiens 
2010-06-24 | E-GEOD-13206 | biostudies-arrayexpress
TranscriptomicsMouse Sirt6-/- RelA+/- tissues
We harvested spleen tissue from Sirt6-/- or Sirt6-/- RelA+/- animals and then completed genome-wide microarray analysis. Total RNA was extracted with TRIzol (Invitrogen) and amplified with Amino Allyl MessageAmp II Amplification kit. Amplified age-matched wild-type tissues were used as reference RNA...
ORGANISM(S): Mus musculus 
2010-06-24 | E-GEOD-13209 | biostudies-arrayexpress
TranscriptomicsRole of CSN5 in breast cancer (siRNA transfections)
CSN5 has been implicated as a candidate oncogene in human breast cancers by genetic linkage with activation of the poor-prognosis, wound response gene expression signature. CSN5 is a subunit of the eight-protein COP9 signalosome, a signaling complex with multiple biochemical activities; the mechanis...
ORGANISM(S): Homo sapiens 
2010-06-29 | E-GEOD-9204 | biostudies-arrayexpress
TranscriptomicsScleroderma and Gleevec treatment
Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labele...
ORGANISM(S): Homo sapiens 
2009-03-31 | E-GEOD-11130 | biostudies-arrayexpress
TranscriptomicsRole of CSN5 in breast cancer
CSN5 has been implicated as a candidate oncogene in human breast cancers by genetic linkage with activation of the poor-prognosis, wound response gene expression signature. CSN5 is a subunit of the eight-protein COP9 signalosome, a signaling complex with multiple biochemical activities; the mechanis...
ORGANISM(S): Homo sapiens 
2010-06-29 | E-GEOD-9206 | biostudies-arrayexpress
TranscriptomicsRole of CSN5 in breast cancer (array CGH)
CSN5 has been implicated as a candidate oncogene in human breast cancers by genetic linkage with activation of the poor-prognosis, wound response gene expression signature. CSN5 is a subunit of the eight-protein COP9 signalosome, a signaling complex with multiple biochemical activities; the mechanis...
ORGANISM(S): Homo sapiens 
2010-06-29 | E-GEOD-9205 | biostudies-arrayexpress
TranscriptomicsCell cycle motif decoy oligos
Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGC...
ORGANISM(S): Homo sapiens 
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
TranscriptomicsMCF10A_MYC_PLUS_CSN5
Gene expression signatures encompassing dozens to hundreds of genes have been associated with many important parameters of cancer, but mechanisms of their control are largely unknown. Here we present a method based on genetic linkage that can prospectively identify functional regulators driving larg...
ORGANISM(S): Homo sapiens 
2010-07-01 | E-GEOD-2824 | biostudies-arrayexpress
Sort   by:  
 Page size