Sort   by:  
 Page size 
TranscriptomicsHeLa cell response to overexpression of wild type and mutated forms of the P19 splice variant of c-H-ras
The c-H-ras proto-oncogene undergoes alternative splicing of the exon termed IDX giving rise to a novel protein of the Ras family, p19 (H-RasIDX). The experiment tests the effect on the transcriptome of overexpressing the wild type and W164A mutated forms of p19. Keywords: genetic modification Thre...
ORGANISM(S): Homo sapiens 
2009-12-29 | E-GEOD-12059 | biostudies-arrayexpress
ProteomicsThe transcriptome, extracellular proteome and active secretome of agroinfiltrated N. benthamiana uncover an expanded protease repertoire
Background: The infiltration of disarmed Agrobacterium tumefaciens into leaves of Nicotiana benthamiana (agroinfiltration) is a widely-adopted procedure to produce and study proteins in plant science, for instance to determine subcellular localization and protein-protein interactions. Agroinfiltrati...
ORGANISM(S): Agrobacterium fabrum str. C58 Nicotiana benthamiana 
2017-10-24 | PXD006708 | Pride
Activity-based proteomics Rnaseq Agroinfiltration Extracellular proteome Post-translational activation Silencing inhibitor p19 Plant immunity Nicotiana benthamiana Activity-based protein profiling (abpp) Agrobacterium tumefaciens Plant protease family Plant protease annotation Chlorosis 
GenomicsNucleoporin Nup153 Regulates Stem Cell Pluripotency through Gene Silencing
Nucleoporins (Nups) are a family of proteins best known as the constituent building blocks of nuclear pore complexes (NPCs), the transport channels that mediate nuclear transport. Recent evidence suggest that several Nups have additional roles in controlling the activation and silencing of developme...
ORGANISM(S): Mus musculus 
2015-06-19 | E-GEOD-64008 | biostudies-arrayexpress
TranscriptomicsP19 cells+LIN28_RA-differentiated_Day 4
LIN28 is an RNA-binding protein expressed in many developing tissues. It can block let-7 microRNA processing and help promote pluripotency. We observe LIN28 expression in the developing neural tube, colocalizing with SOX2, suggesting a role in neural development. To better understand its normal deve...
ORGANISM(S): Mus musculus 
2010-03-03 | E-GEOD-19705 | biostudies-arrayexpress
TranscriptomicsRNAi profiling by array of mouse P19 cells to investigate how SR proteins coordinate gene expression programs
Members of the SR protein family of RNA binding proteins play numerous roles in gene expression, including the regulation of pre-mRNA splicing, mRNA export, and translation. How SR proteins coordinate gene expression programs has been largely unexplored, and comprehensive knowledge of endogenous mRN...
ORGANISM(S): Mus musculus 
2010-07-20 | E-MEXP-2640 | biostudies-arrayexpress
UnknownDifferential effects of p19(Arf) and p16(Ink4a) loss on senescence of murine bone marrow-derived preB cells and macrophages.
Not available
S-EPMC55507 | biostudies-literature
TranscriptomicsExpression signatures of human HeLa cells with RNAi targetting A1 hnRNP, FUS, H hnRNP and p68-DDX5
Transcription profiling of human HeLa cells (cervical cancer cell line) transfected with a plasmid expressing shRNAs cloned into the pSuper expression vector compared to emprty vector negative controls for transfection. Four different RNA interference treatments targetted: A1 hnRNP (HNRNPA1, Heterog...
ORGANISM(S): Homo sapiens 
2008-08-20 | E-GEOD-12058 | biostudies-arrayexpress
TranscriptomicsGIM musmusculus anti-Dicer RNAi silencing
We used the TriFectaTM (IDT, Integrated DNA Technologies,

Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. C...
ORGANISM(S): Mus musculus 
2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress
TranscriptomicsPrevention of mammary tumor progression by silencing HoxA1 via intraductal injection of nanoparticle-formulated siRNA
Silencing HoxA1 in vivo by intraductal delivery of nanoparticle-formulated siRNA reduced mammary tumor incidence by 75% , reduced cell proliferation, and prevented loss of ER and PR expression. 8 week wild type FVB mouse whole mammary gland and 8week to 20 week transgenic FVB C3(1)-SV40Tag mouse who...
ORGANISM(S): Mus musculus 
2013-12-31 | E-GEOD-50813 | biostudies-arrayexpress
TranscriptomicsMIWI catalysis is required for piRNA amplification-independent LINE1 transposon silencing
This SuperSeries is composed of the following subset Series: GSE32180: MIWI catalysis is required for piRNA amplification-independent LINE1 transposon silencing [microarray] GSE32184: MIWI catalysis is required for piRNA amplification-independent LINE1 transposon silencing [deep sequencing] Refer to...
ORGANISM(S): Mus musculus 
2011-11-30 | E-GEOD-32183 | biostudies-arrayexpress
Sort   by:  
 Page size