Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

ABSTRACT: The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)₂(qdppz)]²⁺ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T₁₈), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T₁₀-T₁₁-A₁₂. The two remaining wide lateral loops are linked through a third K⁺ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

SUBMITTER: McQuaid KT 

PROVIDER: S-EPMC8991003 | biostudies-literature | 2022 Apr

REPOSITORIES: biostudies-literature