Plant metagenome
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA395491 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:A Metagenomics Data for Taiwan Oolong Teas 16S rRNA by Illumina MiSeq Genome sequencing
| PRJNA393910 | ENA
Project description:Illumina MiSeq high-throughput sequencing Raw sequence reads
| PRJNA588632 | ENA
Project description:RAG initiates V(D)J recombination in developing lymphocytes by generating "on-target" DNA double-stranded breaks at bona fide recombination signal sequence (RSS) pairs. We now employ RAG-generated DNA breaks in endogenous or ectopically-inserted RSS pairs as bait to identify huge numbers of RAG "off-target" sites. These off-target DNA breaks occur across convergent CTCF-binding element (CBE)-flanked loop domains containing the bait RSS pairs. Such off-target cleavage occurs at the simple CAC motif that defines the RSS cleavage-site and shows orientation-dependence best explained by a two-dimensional tracking mechanism. Deletion of the CBE-based IGCR1 IgH regulatory element disrupts antibody IgH recombination domains and, correspondingly, alters distributions of RAG on- and off-targets across the IgH locus. RAG off-targets frequently involved in chromosomal translocations occur in convergent RSS pairs at enhancer regions within a loop. Our findings reveal how RAG is developmentally focused and re-focused in lymphocytes and implicate mechanisms by which chromatin domains harness biological processes within them. We performed high-throughput genome-wide translocation sequencing (HTGTS) in progenitor B cells or cell lines to study signatures of RAG on and off-targeting activity using RAG-generated breaks in endogenous or ectopically-inserted paired bona fide RSSs as bait. Sequenceing was dong by Illumina Miseq.
2015-09-15 | E-GEOD-73007 | biostudies-arrayexpress
Project description:In this project, in vitro selection was carried out to generate DNAzymes for Eosinophil peroxidase using a synthetic DNA library. Total 15 rounds of selections were carried out. The DNA molecules obtain in round 15, was applied in Illumina MiSeq deep sequencing which provided fastq files. Sequencing samples were prepared from each parallel SELEX experiment by PCR tagging with Illumina sequencing primers. Samples were size purified by agarose gel electrophoresis prior to being quantified by measuring absorbance at 260 nm. Tagged samples were pooled and paired-end sequenced on an Illumina MiSeq high-throughput DNA sequencer. Sequence data processing was performed on a Windows 10 computer running Ubuntu 20.04 under WSL2. Raw paired-end reads were trimmed of sequencing and library primers using cutadapt 3.4. Trimmed paired-end reads were then: 1) merged into a consensus sense read; 2) dereplicated; and, 3) clustered at 90% identity using USEARCH v11.0.667_i86linux32. Sequence frequencies and ranking lists were generated using custom Python scripts. Multiple sequence alignments were performed using MUSCLE v3.8.1551 and converted to sequence logos using WebLogo 3.7.8. Processed sequencing data and cluster linkage data were stored on a MySQL 8.0.22 database. Analysis of sequence copy number, frequency, cluster linkage and data plots were performed using the database and Microsoft Excel Top 20 sequences were tested for cleavage performance. The most active DNAzyme was characterized and optimized. At the end, fluorescence and lateral flow assays were developed and evaluated in real patients' sputums.
2023-11-15 | GSE217946 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
2022-08-24 | GSE206807 | GEO
Project description:Illumina MiSeq high-throughput sequencing for six opencast coal mine sites Raw sequence reads
| PRJNA533184 | ENA