Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions.
Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.
Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.
Project description:Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
Project description:Chromosomal translocations juxtaposing the androgen-responsive TMPRSS2 promoter with the ETS-family transcription factor ERG result in aberrant ERG up-regulation in approximately 50% of prostate cancers. Studies to date have demonstrated important roles of ERG in inducing oncogenic properties of prostate cancer. Its molecular mechanisms of action, however, are yet to be fully understood. To address these questions, we generated engineered LNCaP cells with ERG overexpression followed by LEF1 knockdown as well as control cell lines. To further investigate the role of LEF1 in ERG fusion positive samples, we also knockdown ERG in VCaP cell line. We performed microarray analysis on LNCaP cells with ERG overexpression followed by LEF1 knockdown using siRNA. We also knockdown endogenous ERG in fusion-positive cell line VCaP.
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Project description:Androgen receptor (AR) is a transcription factor that plays a central role in the growth and development of the normal prostate and its malignant transformation. More recently, a majority of prostate cancers have been shown to harbor recurrent gene fusions of the androgen-regulated gene, TMPRSS2, to the oncogenic ETS transcription factor ERG. Here we employed chromatin immunoprecipitation coupled to massively parallel sequencing (ChIP-Seq) to explore the genome-wide localization of these transcription factors in human prostate cancer cell lines as well as tissues. Unexpectedly, transcriptional networks emanating from AR and ERG were found to be highly overlapping. Furthermore, AR was found to regulate known 5’ fusion partners in prostate cancer including TMPRSS2, as well as negatively regulating its own expression. While induced by androgen through fusion to TMPRSS2, ERG itself was shown to inhibit AR expression and positively regulate the genomic locus of wild-type ERG, thus revealing multiple levels of molecular cross-talk between AR and ERG. Importantly, androgen-sensitive prostate cancer cells in which ERG is overexpressed are able to proliferate and invade in the absence of androgen. Thus, we dissected the intertwined genomic landscape of two master transcriptional regulators of prostate cancer and suggest a role for ERG in maintaining transcriptional networks necessary for androgen-independent prostate cancer growth. These studies may suggest that future therapies against prostate cancer should target both AR and ERG, rather than AR alone, in order to achieve maximum effectiveness. ChIP_Seq examination of histone modifications and key transcription factors in LNCaP and VCaP prostate cancer cell lines in un-treated, vehicle treated or 10nM R1881 treated conditions. LNCaP ChIP-Seq experiments include samples GSM353609-GSM353618, GSM353625-GSM353628, GSM353633-GSM353635, GSM353641-GSM353644, and GSM353648. VCaP ChIP-Seq experiments include samples GSM353601-GSM353608, GSM353619-GSM353624, GSM353629-GSM353632, and GSM353645-GSM353647. In addition, we performed re-ChIP of AR and ERG in VCaP cells (GSM356767), and examined the effect of ERG knockdown on AR and ERG binding (samples GSM353636-GSM353639). To study ectopic ERG binding we performed ERG ChIP-Seq in stable RWPE+ERG or control cells (samples GSM353649-GSM353650). AR ChIP-Seq was also done in the AR-positive but ETS fusion-negative 22RV1 cells (GSM353640). To further study transcription factor binding and chromatin state we performed ChIP-Seq of AR, ERG, H3K4me3, H3K9me3, H3K27me3 and RNA Pol II in a metastatic prostate tumor tissue (samples GSM353651-GSM353656). To couple the ChIP-Seq experiments with gene expression, we have also done Illumian SAGE-tag profiling in LNCaP cells following androgen treatment for 0, 24 and 48hrs. These DGE experiments correspond to samples GSM353657-GSM353659.
Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell.
Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.