Dataset Information

Structural basis of the mitochondrial RNA editing cascade in trypanosomes

ABSTRACT: The discovery of RNA editing in trypanosomes introduced the concept of guide RNA (gRNA). To understand how the RECC1 and RECC2 complexes mediate gRNA-directed uridine deletions and insertions, respectively, in mitochondrial mRNAs, we determined their structures and RNA interactions. The RECC cores, consisting of distinct heterotetramers of active and inactive RNase III endonucleases, recognize gRNA–mRNA duplexes. Auxiliary zinc-finger domains distinguish deletion from insertion editing sites, while asymmetrical catalytic centers cleave the mRNA. Three peripheral heterotetramers composed of oligonucleotide-binding (OB-fold) proteins flexibly tether exonuclease, TUTase, and ligase enzymes to the cores, facilitating trimming or extension of cleaved mRNA and strand repair. An architectural tRNA stabilizes the RNase III–OB-fold interface. These findings illuminate the organization of the enzymatic cascade and suggest a mechanism for editing site recognition.

INSTRUMENT(S):

ORGANISM(S): Trypanosoma Brucei

SUBMITTER: Clinton Yu

LAB HEAD: Dr. Ruslan Afasizhev

PROVIDER: PXD068847 | Pride | 2026-06-15

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

Items per page:

1 - 5 of 26

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

			Action	DRS
	DSSO_01.txt	Txt
	DSSO_02.txt	Txt
	DSSO_F20.txt	Txt
	DSSO_F22.txt	Txt
	DSSO_F24_01.txt	Txt

Dataset Information

Structural basis of the mitochondrial RNA editing cascade in trypanosomes

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets