Sort   by:  
 Page size 
TranscriptomicsOryza sativa, Nipponbare RNA-Seq - Conserved Poaceae Specific Genes Project
Illumina RNA Sequencing (RNA-Seq) of Oryza sativa, Nipponbare for the Conserved Poaceae Specific Genes project. Authors: Robin Buell, Ning Jiang, Haining Lin, Rebecca Davidson, Malali Gowda, John Hamilton, Brieanne Vaillancourt
ORGANISM(S): Oryza sativa Japonica Group 
2012-04-04 | E-MTAB-2039 | biostudies-arrayexpress
ProteomicsA role for the putative error-prone polymerase REV1 in DNA damage and antifungal drug resistance in Candida albicans
Antimicrobial-induced DNA damage, and subsequent repair via upregulation of DNA repair factors, including error-prone translesion polymerases, can lead to the increased accumulation of mutations in the microbial genome, and ultimately increased risk of acquired mutations associated with antimicrobia...
ORGANISM(S): Candida albicans (Yeast) 
2025-05-07 | PXD055008 | Pride
Candida albicans Rev1 Fungal 
MetabolomicsExometabolomic-enabled discovery of compounds associated with Escherichia coli O157:H7 population dynamics in the lettuce phyllosphere

Contamination of fresh produce with human pathogens remains a serious public health and economic concerns due to the absence of effective kill steps in the farm-to-fork chain. In particular, the pathogenic Escherichia coli O157:H7 has been implicated in multiple illness outbreaks linked to lettuc...

2026-06-11 | MTBLS14653 | MetaboLights
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
ProteomicsO-GlcNAc Containing Proteins in Normal and Idiopathic Pulmonary Fibrosis Human Fibroblasts
Isolated normal and IPF fibroblasts were homogenized in cold MilliQ water using a bullet blender. Samples were centrifuged and inhibitors were added: HALT (Thermo Fisher Scientific), Z-Pugnac (Tocris), Thiamet G (Cayman Chemicals), and benzonase (E1014, Millipore, Sigma). O-GlcNAc enzymatic labeling...
ORGANISM(S): Homo Sapiens (ncbitaxon:9606) 
2023-11-21 | MSV000093453 | MassIVE
TranscriptomicsTransposable element expression at unique loci in single cells with CELLO-seq
We introduce a novel method (CELLO-seq) for long-read RNA sequencing at single cell resolution. CELLO-seq allows for full-length RNA sequencing and enables measurement of allelic, isoform and Transposable Element (TE) expression at unique loci. We use CELLO-seq to assess the widespread expression of...
ORGANISM(S): Homo sapiens 
2020-10-01 | E-MTAB-9577 | biostudies-arrayexpress
ProteomicsRdRp MALDI Data Set - 2022, Slavish/Rimmer
Chemical scaffold recycling: Structure-guided conversion of an HIV integrase inhibitor into a potent influenza virus RNA-dependent RNA polymerase inhibitor designed to minimize resistance potential Eur J Med Chem. 2023 Feb 5;247:115035. doi: 10.1016/j.ejmech.2022.115035. Epub 2022 Dec 22. Slavish, ...
ORGANISM(S): Influenza Virus A/california/04/2009 
2023-07-06 | MSV000092363 | MassIVE
TranscriptomicsMET Amplified Gastric Cancer Cell Lines +/- Crizotinib
MET amplification is present in 20% of gastric cancers and has been confirmed as a therapeutic target in clinical trials. The molecular mechanisms of response and resistance to MET inhibitors are not well understood. We investigated the determinants of MET dependency in human gastric cancer. MET in...
ORGANISM(S): Homo sapiens 
2016-05-13 | E-GEOD-77320 | biostudies-arrayexpress
ProteomicsProteomic profiling maps the molecular pathways underlying the neuroprotective effects of the kinase inhibitor BX795 in a patient-derived model of Parkinson's disease
Disease-modifying therapies remain an important unmet need for neurodegenerative diseases, including Parkinson’s disease (PD). The aim of this study was to investigate the molecular pathways affected by the multi-kinase inhibitor BX795, which is neuroprotective in an induced pluripotent stem cell (i...
ORGANISM(S): Homo sapiens (Human) 
2023-03-10 | PXD019574 | Pride
Proteomics Mrna metabolism Induced pluripotent stem cell derived neurons Bx795 P.a53t α-synuclein mutation Proteostasis Α-synuclein 
TranscriptomicsTotal RNA-sequencing Detects Transcriptome Differences in Mouse Preosteoblast Response to Bulk Nanostructured Titanium
Titanium is the most widely used alloy family in dental and orthopedic implants due to its natural ability to integrate into bone, but cytotoxic alloying elements are required in titanium for its mechanical properties to match the functionality of natural bone in high-load bearing applications. Rece...
ORGANISM(S): Mus musculus 
2020-01-02 | E-MTAB-7528 | biostudies-arrayexpress
Sort   by:  
 Page size