Sort   by:  
 Page size 
MetabolomicsStable Isotope–Assisted Plant Metabolomics: Combination of Global and Tracer-Based Labeling for Enhanced Untargeted Profiling and Compound Annotation
Untargeted approaches and thus biological interpretation of metabolomics results are still hampered by the reliable assignment of the global metabolome as well as classification and (putative) identification of metabolites. In this work we present an liquid chromatography-mass spectrometry (LC-MS)-b...
2020-02-09 | MTBLS1217 | MetaboLights
TranscriptomicsMARS-seq Version 2
scRNA-seq procedure and analysis. ScRNA-seq was performed using the Massively Parallel Single-Cell RNA-sequencing technology (MARS-seq) as described by Jaitin et al., 2014 (PMID: 24531970) EpiSCs were seeded at ~6 x 103 cells/cm2 in 6-well cell-culture plates pre-coated with 15 µg/ml human Fibronec...
ORGANISM(S): Mus musculus 
2025-04-28 | E-MTAB-13660 | biostudies-arrayexpress
TranscriptomicsSingle-cell RNA-seq of wild-type and Pbx1/Pbx2 double-knockout EpiSCs differentiated in vitro to pre-somitic mesoderm in the first 48 hours of differentiation.
In vertebrates, body axis elongation is fuelled by bipotent neuromesodermal progenitors (NMPs), which support the development of both spinal cord and paraxial mesoderm (PM). HOX transcription factors have been historically implicated in axial elongation, with their sequential activation playing a fu...
ORGANISM(S): Mus musculus 
2021-07-21 | E-MTAB-9774 | biostudies-arrayexpress
TranscriptomicsSingle-cell RNA-seq of tailbuds from control, Pbx1/Pbx2 compound and Pbx1/Pbx2 double-knockout E8.5/E9.0 embryos.
In vertebrates, body axis elongation is fuelled by bipotent neuromesodermal progenitors (NMPs), which support the development of both spinal cord and paraxial mesoderm (PM). NMPs reside in the caudal lateral epiblast and tailbud, from where they sustain axial elongation. HOX transcription factors ha...
ORGANISM(S): Mus musculus 
2021-07-21 | E-MTAB-9785 | biostudies-arrayexpress
MetabolomicsAn Unbiased Lipid Phenotyping Approach To Study the Genetic Determinants of Lipids and Their Association with Coronary Heart Disease Risk Factors
Direct infusion high-resolution mass spectrometry (DIHRMS) is a novel, high-throughput approach to rapidly and accurately profile hundreds of lipids in human serum without prior chromatography, facilitating in-depth lipid phenotyping for large epidemiological studies to reveal the detailed associati...
2024-02-02 | MTBLS4461 | MetaboLights
ProteomicsEpidermal growth factor shedding directs macrophage education in cancer
Macrophages in the tumor microenvironment have a significant impact on tumor progression. Depending on the signaling environment in the tumor, macrophages can either support or constrain tumor growth and metastasis. It is therefore of therapeutic interest to identify the tumor-derived factors that c...
ORGANISM(S): Mus musculus (Mouse) 
2022-09-18 | PXD030740 | Pride
Conditioned medium Lc-msms Mouse Tmt Prm Adam17 Hb-egf 4t1 
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
ProteomicsProteomic Analysis of the IPF Mesenchymal Progenitor Cell Nuclear Proteome Identifies Abnormalities in Key Nodal Proteins That Underlie Their Fibrogenic Phenotype
IPF is a progressive fibrotic lung disease whose pathogenesis remains incompletely understood. We have previously discovered pathologic mesenchymal progenitor cells (MPCs) in the lungs of IPF patients. IPF MPCs display a distinct transcriptome and create sustained interstitial fibrosis in immune def...
ORGANISM(S): Homo sapiens (Human) 
2022-08-12 | PXD032352 | Pride
Ingenuity pathway analysis Mesenchymal progenitor cells (mpcs) Nuclear fraction Differentiation Quantitative mass spectrometry Apoptosis Idiopathic pulmonary fibrosis (ipf) Dna damage 
GenomicsEGAS00001000262-sc-20140722 - samples
To characterize the subclonal genomic architecture of androgen-deprived metastatic prostate cancer, we performed whole-genome sequencing (WGS) of 51 tumours from 10 patients to an average sequencing depth of 55x, including multiple metastases from different anatomic sites in each patient and, in fiv...
EGAD00001000891 | EGA
Proteomicsmir-1 coordinately regulates lysosomal v-ATPase and biogenesis to affect muscle contractility upon proteotoxic challenge during ageing
Muscle function relies on the precise architecture of dynamic contractile elements, which must be fine-tuned to maintain motility throughout life. Muscle is also highly plastic, and remodeled in response to stress, growth, neural and metabolic inputs. The evolutionarily conserved muscle microRNA, mi...
ORGANISM(S): Caenorhabditis elegans 
2021-07-14 | PXD023544 | Pride
Lfq Worm 
Sort   by:  
 Page size