Sort   by:  
 Page size 
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
ProteomicsobABPP-HT*: A Precision-Engineered Activity Proteomics Pipeline for the Streamlined Discovery of Deubiquitinase Inhibitors
Deubiquitinases (DUBs), and the dysregulation thereof, are implicated in human disease. The recent inclusion of selective DUB inhibitors in clinical trials has heightened interest in DUB-focused drug discovery. Current DUB screening methods remain constrained, however, as they often rely on recombin...
ORGANISM(S): Homo sapiens (Human) 
2026-10-09 | PXD064209 | Pride
Lc-ms/ms Otud7b Inhibitor Activity-based probe profilling (abpp) Usp5 Deubiquitinase Usp47 Deisgylase Ubiquitin Screen Usp7 
GenomicsTranscription Dynamically Patterns the Meiotic Chromosome-Axis Interface
Meiotic chromosomes are highly compacted yet remain transcriptionally active. To understand how chromosome folding accommodates transcription, we investigated the assembly of the axial element, the proteinaceous structure that compacts meiotic chromosomes and promotes recombination and fertility. We...
ORGANISM(S): Saccharomyces cerevisiae SK1 
2015-08-07 | E-GEOD-70112 | biostudies-arrayexpress
ProteomicsCovalent Fragment Screening and Optimization Identifies Chloroacetohydrazide Scaffold as Inhibitors for Ubiquitin C- terminal Hydrolase L1
Dysregulation of the ubiquitin-proteasome systems is a hallmark of various disease states including neurodegenerative diseases and cancer. Ubiquitin C-terminal Hydrolase L1 (UCHL1), a deubiquitinating enzyme, is expressed primarily in the central nervous system under normal physiological conditions,...
ORGANISM(S): Homo sapiens (Human) 
2026-10-09 | PXD045257 | Pride
Breast cancer Covalent inhibitor Deubiquitinating enzyme Chloroacetohydrazide Uchl1 Chloroacetamide Ubiquitin c-terminal hydrolase l1 Dub Probe discovery 
GenomicsGenome-scale expression and transcription factor binding profiles reveal therapeutic targets in transgenic ERG myeloid leukemia
Here we show that pan-haematopoietic ERG expression driven by the Vav promoter induces an early progenitor myeloid leukemia in transgenic mice. Integrated genome-scale analysis of gene expression and ERG binding profiles revealed that ERG activates a transcriptional program similar to human AML stem...
ORGANISM(S): Mus musculus 
2013-08-30 | E-GEOD-46554 | biostudies-arrayexpress
TranscriptomicsRUNX1 reshapes the epigenetic landscape at the onset of hematopoiesis
Cell fate decisions during hematopoiesis are governed by lineage-specific transcription factors, such as RUNX1, SCL/TAL1, FLI1 and C/EBP family members. In order to gain insight about how these transcription factors regulate the activation of hematopoietic genes during embryonic development, we meas...
ORGANISM(S): Mus musculus 
2013-02-11 | E-GEOD-39662 | biostudies-arrayexpress
GenomicsRUNX1 reshapes the epigenetic landscape at the onset of hematopoiesis
Cell fate decisions during hematopoiesis are governed by lineage-specific transcription factors, such as RUNX1, SCL/TAL1, FLI1 and C/EBP family members. In order to gain insight about how these transcription factors regulate the activation of hematopoietic genes during embryonic development, we meas...
ORGANISM(S): Mus musculus 
2012-10-18 | E-GEOD-40235 | biostudies-arrayexpress
TranscriptomicsEts factors regulate neural stem cell depletion and gliogenesis in Ras pathway-driven glioma
As the list of putative driver mutations in glioma grows, we are just beginning toAs the list of putative driver mutations in glioma grows, we are just beginning to elucidate the effects of dysregulated developmental signaling pathways on the transformation of neural cells. We have employed a postn...
ORGANISM(S): Mus musculus 
2015-05-28 | E-GEOD-69254 | biostudies-arrayexpress
GenomicsThe Growth factor independence 1 (GFI1) 36N variant predisposes to Acute Myeloid Leukemia (AML) by inducing epigenetic changes at the Hoxa9 locus
GFI136N is a coding Single Nucleotide Polymorphism (SNP) in the gene GFI1 that increases the risk for Acute myeloid leukemia (AML) by 60%. It is present in 3-5% of Caucasians and has a prevalence of 12% among AML patients. We generated knockin mice expressing either the human GFI136N variant or the ...
ORGANISM(S): Mus musculus 
2012-12-04 | E-GEOD-31657 | biostudies-arrayexpress
TranscriptomicsTranscriptome profiling of deciduas from pre-eclamptic and normotensive pregnancies
Genome-wide analysis of decidual transcriptome in pre-eclampsia compared with normotensive controls to find differentially expressed genes/pathways. Preeclampsia (PE) is a common and serious pregnancy hypertensive disorder with a strong genetic component. The study aims were to use genome-wide analy...
ORGANISM(S): Homo sapiens 
2015-08-05 | E-GEOD-60438 | biostudies-arrayexpress
Sort   by:  
 Page size